Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
Question:
GGAUCCCGCUUUGGGCUGAAAUAG
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 83% (12 reviews)
Mark off the message into triplets b...View the full answer
Answered By
Ayush Mishra
I am a certified online tutor, with more than 3 years of experience in online tutoring. My tutoring subjects include: Physics, Mathematics and Mechanical engineering. I have also been awarded as best tutor for year 2019 in my previous organisation. Being a Mechanical Engineer, I love to tell the application of the concepts of science and mathematics in the real world. This help students to develop interest and makes learning fun and easy. This in turn, automatically improves their grades in the subject. I teach students to get prepared for college entry level exam. I also use to teach undergraduate students and guide them through their career aim.
5.00+
2+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Complete hydrolysis of a heptapeptide showed that it has the following constituent amino acids: 2A, E, L, K, F, V Deduce the amino acid sequence of this heptapeptide from the following data. 1....
-
Give the amino acid sequence of the following polypeptides using only the data given by partial acidic hydrolysis: (a) (b) S, O, P, T H2o STTO PS A, R, C, V, LAC + CR+RV +LA H20
-
An important validation of the genetic code occurred when George Streisinger determined the amino acid sequence of bacteriophage T4 lysozyme and of mutants induced by proavin, a dye with a planar...
-
Sparkle is one firm of many in the market for toothpaste, which is in long-run equilibrium. a. Draw a diagram showing Sparkles demand curve, marginal-revenue curve, average total- cost curve, and...
-
1. Should this venture be regarded as entrepreneurial? Is the owner a true entrepreneur? 2. Do you agree with the philosophy expressed here? Is the owner really doing what is best for his family? 3....
-
Selected costs associated with a variety of business situations are shown below: (a) Salary of the plant manager. (b) Lubricating oils for machines. (c) Brass rods used in making plumbing products....
-
Agency Theory. Identify principals and agents in the cases mentioned below. Describe the contributions and prices associated with these relationships, identify potential risks for the principal and...
-
The trial balance of Dominic Company shown below does not balance. Your review of the ledger reveals that each account has a normal balance. You also discover the following errors. 1. The totals of...
-
1 . Compute cost of goods sold and the cost of ending inventory using FIFO. 2 . Compute cost of goods sold and the cost of ending inventory using LIFO. 3 . Compute cost of goods sold and the cost of...
-
The Modigliani-Miller theorem assumes that the firm has only two classes of securities, perpetual debt and equity. Suppose that the firm has issued a third class of securities-preferred stock-and...
-
Would RNA of a certain percentage composition of guanine and cytosine denature more or less readily than RNA with a lower percent of guanine and cytosine? Why?
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
Discuss the importance of predictions and assumptions in the budgeting process.
-
Jasons Corp balance sheet as of December 3 1 , 2 0 2 1 , reveals the following information.Preferred stock, $ 1 0 0 par $ 6 0 0 , 0 0 0 Paid - in capital in excess of parpreferred 5 0 , 0 0 0 Common...
-
Assume that the parent company's home currency is weak today and will strengthen over time relative to a foreign subsidiary's currency. Develop a hypothetical example for the parent/subsidiary...
-
Cody apologized to Kaitlin for saying that she did not work hard to support her staff at We Know Beans. Kaitlin replied, It s okay. I can understand where you're coming from I ve had lots of...
-
A business presents the following information related to its ABC product: Budgeted unit sales price $ 1 0 0 Actual unit sales price $ 1 0 2 Budgeted sales volume 2 1 , 0 0 0 units Actual sales volume...
-
Given the following code: vector numbers; for (int i = 0; i
-
The Framework states that understandability is an enhancing qualitative characteristic. Is this consistent with the huge complexity in financial statements?
-
A consumer magazine is evaluating five brands of trash compactors for their effectiveness in reducing the volume of typical household products that are discarded. In the experiment, each block...
-
Repeat problem 11.54 for the network shown in fig 11.62. R2
-
In all OTA problem, the specifications are gm - Iabc sensitivity = 20, maximum gm = 1mS with range of 4 decades. For the circuit in figure 11.50, find gm and Iabc values required for a simulated...
-
In all OTA problem, the specifications are gm - Iabc sensitivity = 20, maximum gm = 1mS with range of 4 decades. For the circuit in figure 11.53, find gm and Iabc values required for a simulated...
-
Attempts: 1 of 3 used ( b ) Prepare a responsibility report for the Women's Shoes Division assuming ( 1 ) the data are for the month ended June 3 0 , 2 0 2 2 , and ( 2 ) all data equal budget except...
-
Bonita Corporation is a regional company which is an SEC registrant. The corporation's securities are thinly traded on NASDAQ. Bonita Corp. has issued 1 4 , 5 0 0 units. Each unit consists of a $ 7 2...
-
The company purchased equipment on april 1 2 0 1 9 costing $ 1 0 0 , 0 0 0 from dealer on credit , amount payable after three months. the useful life of the asset is estimated at 1 0 yrs with a...
Study smarter with the SolutionInn App