List the codons to which the following anticodons would form base pairs: Anticodon: GAC UGA GGG ACC
Question:
Anticodon: GAC UGA GGG ACC
Codon:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 54% (11 reviews)
The codons have bases that a...View the full answer
Answered By
Rohith Bellamkonda
I am studying in IIT Indore,the most prestigious institute of India.I love solving maths and enjoy coding
5.00+
1+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
List the anticodons to which the following codons would form base pairs: Codon: UUG CAC ACU GAA
-
According to wobble rules, what codons should be recognized by the following anti-codons? What amino acid residues do these correspond to? (a) 5 - ICC - 3 (b) 5 - GCU -3
-
Which of the following amino acids are likely to be linked to only one species of tRNA? What are their anticodons? (a) Phe (b) Leu (c) His
-
Chris Co. purchased a piece of equipment and incurred the following costs. Which of these costs is properly capitalized and recorded as part of the cost of the equipment? I. Freight charges to...
-
What is meant by the term entrepreneur?
-
Can management accountants survive now?
-
Discuss the new objects of assurance services.
-
Kolton Company closes its books on its July 31 year-end. The company does not make entries to accrue for interest except at its year-end. On June 30, the Notes Receivable account balance is $23,800....
-
During April 2 0 2 4 , Marigold Company incurred the following transactions. This is Marigold's first period of operations, and they plan to use the periodic method of accounting for inventory....
-
Puff n Stuff Services is a small company that assembles mailings for clients in the Atlanta area. Different-size envelopes are stuffed with various items such as coupons, advertisements, political...
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
Explain how the doping of polyacetylene increases its electrical conductivity.
-
Brian convinces his friend Joe, who prefers to stay home and play video games all day, to go for a hike in the woods one sunny afternoon. During the hike, Brian jokingly pushes Joe and Joe falls over...
-
Assume that you bought an original issue 20-year General Electric (GE) bond with a 7.5% coupon, $1,000 par, paying coupons semi-annually (twice a year, every six months). You bought the bond just...
-
Because Reginald got fired from his previous job, he was able to land a new gig as a production manager at Widgets of America. He's only been on the job for 3 weeks. However, he shared with all of...
-
If crimes categorised as burglary and bicycle theft are independent events, what is chance (expressed in percentage) of being a victim of both crimes next year in Dorset Region Burglary Bicycle...
-
Two investors are considering purchasing Home Depot (HD) common stock. The investors agree on the expected values of Div1 ($6.36) and the expected future dividend growth rate (2%). They also agree on...
-
During the year CorpH, a PEI - based corporation, had the following transactions: Purchased an automobile in Nova Scotia for $ 3 2 , 0 0 0 ( including GST / HST ) . Leased an automobile from a...
-
Assume you are the owner of Double Caf, a coffee shop in Sydneys CBD. At the end of June 2019, you find (for June only) this information: 1. Sales, as per cash register records, of $47 000, plus...
-
On April 29, 2015, Auk Corporation acquires 100% of the outstanding stock of Amazon Corporation (E & P of $750,000) for $1.2 million. Amazon has assets with a fair market value of $1.4 million (basis...
-
Find the transfer function of the OTA filter in figure 11.68. Express Wo and Q in terms of the capacitances and transconductances. What kind of filter is it. Vo 0 en 2 em 3
-
Find the transfer function of the OTA filter in fig 11.69. Express Wo and Q in terms of the capacitances and transconductances. What kind of filters is it? Virl 2 En 1
-
Refer to the ac/dc converter low-pass filter application of example 11.25. If we put the converter to use powering a calculator, the load current can be modeled by a resistor as shown in fig 11.25....
-
Mills Corporation acquired as an investment $ 2 4 0 million of 7 % bonds, dated July 1 , on July 1 , 2 0 2 4 . Company management is holding the bonds in its trading portfolio. The market interest...
-
1 . Journalize Ontario's inventory transactions for the year under the perpetual system . 2 . Report ending inventory, sales, cost of goods sold, and gross profit on the appropriate financial...
-
Rolfe Company ( a U . S . - based company ) has a subsidiary in Nigeria where the local currency unit is the naira ( NGN ) . On December 3 1 . 2 0 1 9 , the subsidiary had the following balance sheet...
Study smarter with the SolutionInn App