Find a factorization of the given matrix A in the form A = PCP -1 , where
Question:
Find a factorization of the given matrix A in the form A = PCP-1, where C is a block-diagonal matrix with 2 x 2 blocks of the form shown in Example 6. (For each conjugate pair of eigenvalues, use the real and imaginary parts of one eigenvector in C4 to create two columns of P.)
Transcribed Image Text:
-1.4 -2.0 -2.0 -2.0 -1.3 -.8 -.1 -.6 .3 -1.9 -1.6 -1.4 3.3 2.3 2.6 2.0
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 63% (11 reviews)
Data from in Theorem 9 14 20 20 20 13 8 1 6 3 19 16 14 20 33 23 ...View the full answer
Answered By
Mehwish Aziz
What I have learnt in my 8 years experience of tutoring is that you really need to have a friendly relationship with your students so they can come to you with their queries without any hesitation. I am quite hardworking and I have strong work ethics. Since I had never been one of those who always top in the class and always get A* no matter what, I can understand the fear of failure and can relate with my students at so many levels. I had always been one of those who had to work really hard to get decent grades. I am forever grateful to some of the amazing teachers that I have had who made learning one, and owing to whom I was able to get some extraordinary grades and get into one of the most prestigious universities of the country. Inspired by those same teachers, I am to be like one of them - who never gives up on her students and always believe in them!
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Linear Algebra And Its Applications
ISBN: 9781292351216
6th Global Edition
Authors: David Lay, Steven Lay, Judi McDonald
Question Posted:
Students also viewed these Mathematics questions
-
In Exercises 27 and 28, find a factorization of the given matrix A in the form A = PCP-1, where C is a block-diagonal matrix with 2 x 2 blocks of the form shown in Example 6. (For each conjugate pair...
-
Find a factorization of the given matrix A in the form A = PCP -1 , where C is a block-diagonal matrix with 2 x 2 blocks of the form shown in Example 6. (For each conjugate pair of eigenvalues, use...
-
Use the LDLt Factorization Algorithm to find a factorization of the form A = LDLt for the following matrices: a. b. c. d. 4 1 A=1-1 30 Li 02 3 422 1138 2163 0311 1114 1021 1301 4111
-
Elfving Company produces a single product. The cost of producing and selling a single unit of this product at the company's normal activity level of 80,000 units per month is as follows: The normal...
-
Use the tools introduced in this chapter to answer the following questions. You have to decide which tool to use in each case. Explain your conclusions. a. An investor purchases a $5,000 investment...
-
Solve the given systems of equations by use of a calculator. y = 2 ln x y = sin x
-
Use the following historic excess returns to ABC Corp. and the market to compute ABC's beta: a. -0.30 b. 0.23 c. 2.30 d. 3.84 Observation Stock Excess Returns (%) Market Excess Returns (%) 1 -5.14...
-
An article in Quality Progress (For Starbucks, Its in the Bag, March 2011, pp. 18-23) describes using a central composite design to improve the packaging of one-pound coffee. The objective is to...
-
A chord AB of a circle, centre O, and radius 21 cm is 36 cm long. a) Express the angle AOB in radians. b) Use your result in (a) to calculate, correct to three significant figures, i) the length of...
-
You decide to sell short 100 shares of Charlotte Horse Farms when it is selling at its yearly high of $56. Your broker tells you that your margin requirement is 45 percent and that the commission on...
-
Find the B-matrix for the transformation x Ax when B = {b 1 , b 2 , b 3 }. A = b = -7 1 -3 -2 -48 14 -45 6,b = ]=[] 1 -3 1,b3 , b3 = -3 -16 -19 3 -[J] 0
-
Diagonalize the matrices, if possible. The eigenvalues are as follows: (11) = 1, 2, 3; (12) = 1, 4; (13) = 5, 1; (14) = 3, 4; (15) = 3, 1; (16) = 2, 1. 5-3 0 3 0 0 0 0 0 9 1-2 2 0 0 2
-
A hypothetical base sequence of an RNA molecule is 5AUUUGCCCUAGCAAACGUAGCAAACG3 Using two of the three underlined parts of this sequence, draw two possible stem-loop structures that might form in...
-
The confirmation of customers accounts receivable rarely provides reliable evidence about the completeness assertion because a. Many customers merely sign and return the confirmation without...
-
To determine whether internal controls operated effectively to minimize errors of failure to invoice a shipment, the auditor would select a sample of transactions from the population represented by...
-
What is batch processing?
-
Briefly describe six reasons why the auditor's approach to obtaining an understanding of internal control is different when a computer is used rather than manual processing.
-
A manufacturing client received a substantial amount of goods returned during the last month of the fiscal year and the first month after year-end. The client recorded the returns when credit memos...
-
Consider the linear regression model 7 = 0 + 1x + e Where 0 = -2,1 = - 1, and the normal random variable e has standard deviation 3. (a) What is the mean of the response y when x = 3? When x = 5? (b)...
-
If a process has a six-sigma capability, what is the process capability index? a. 1 b. 2 c. 6 d. 12
-
How can designed experiments facilitate the application of the Deming PDCA cycle?
-
What is a control chart, and what purpose does it serve?
-
Differentiate between a variable and an attribute.
-
Required: a. Assume that only one product is being sold in each of the four following case situations: b. Assume that more than one product is being sold in each of the four following case...
-
[2] (20pts) The AGGIE Industrial Engineering Entrepreneurs (AGGIE) manufacture customized business card holders (BCHs) using their several lines of additive manufacturing machines (aka 3-D printers)....
-
Nomis Ltd reported the following items on the balance sheet at December 31, 2020. Assets Current assets 23,400 Property, plant and equipment, net 65,400 Total assets 88,800 Liabilities Current...
Study smarter with the SolutionInn App