If a share expects next year's dividend to be$1.35 and the company's average dividend growth rate is

Fantastic news! We've Found the answer you've been seeking!

Question:

If a share expects next year's dividend to be$1.35 and the company's average dividend growth rate is expected to be 6%,then what is the intrinsic value of the share if the market rate is 9.5%?

Related Book For answer-question

Fundamentals of Investments

ISBN: 978-0132926171

3rd edition

Authors: Gordon J. Alexander, William F. Sharpe, Jeffery V. Bailey

See More Books

Posted Date: May 11, 2024 09:02 AM

See More Questions

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
What is the most common measure of the Maintainability Key System Attribute (KSA)?
The value of a share of common stock depends on the cash flows it is expected to provide, and those flows consist of the dividends the investor receives each year while holding the stock and the...
Ivanhoe Company was formed on July 1, 2018 It was authorized to issue 285,500 shares of $10 par value common stock and 95,400 shares of 8 $25 par value, cumulative and nonparticipating preferred...
What does the term manifest imbalance mean to you? Is there manifest imbalance in this case?
What is the AIDA model, and what are its limitations?
How can you identify semi-variable costs and separate them into the fixed and variable elements?
Linda Olsen is studying for the next accounting midterm examination. Summarize for Linda what she should know about management functions.
Activity 2.b-More Practice Preparing the Adjusted Trial Balance Complete the Adjusted Trial Balance as of December 31, 2016 using the given information. Enter accounts in order of assets,...
A firm has been experiencing low profitability in recent years. Perform an analysis of the firm's financial position using the DuPont equation. The firm has no lease payments but has a $3 million...
Discuss at least 4 cost driver for assigning the cost activities and discuss critically discuss which one is high and low cost activities
"Even if you're preapproved for a credit card at a certain interest rate with a specific fee structure, it doesn't mean that that's the card you'll actually get.After the credit card company reviews...
1 . A counterflow heat exchanger is used to transfer heat from a hot fluid at 1 2 0 \ deg C to a cold fluid at 4 0 \ deg C . The hot fluid enters the exchanger at a flow rate of 0 . 2 kg / s and...
Bin Yao developed a new type of ceramic which has been growing its sales in the petrochemical industry. He is considering raising prices by 24% but is concerned that some of his current customers...
Identify five examples of financial investment options available to U.S. households. Identify and briefly explain what will play a role in the choices households make in choosing between these...
Exercise 11-10 (Static) Make or Buy Decision [LO11-3] Futura Company purchases the 40,000 starters that it installs in its standard line of farm tractors from a supplier for the price of $8.40 per...
Cleaning Service Company's Trial Balance on December 31, 2020 is as follows: Account name Debit Credit Cash 700 Supplies Pre-paid insurance Pre-paid office rent Equipment Accumulated depreciation -...
Using the data from question 6, calculate the IRR. How does this impact on your decision making?
The hotel can only fund one of these three projects Cash flows/year 0 1 2 31 41 Total 1 2 3 -6,000 -3,000 -3,000 500 1,700 0 600 1,850 0 3,500 500 0 3,500 650 4,800 2,100 1,700 1,800 Note: these...
As the management accountant, the manager has asked you to explain the merits of the following capital investment appraisal techniques and make recommendations for a capital investment process to be...

If a share expects next year's dividend to be$1.35 and the company's average dividend growth rate is

Question:

Expert Answer:

To calculate the intrinsic value of a share using the dividend ... View the full answer

Fundamentals of Investments

Students also viewed these finance questions