The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer. The figure below shows the recognition sequences and cleavage positions of three restriction enzymes. BamHI Bg/II NdeIl 5'- GGATCC - 3' 3'- CCTAGG - 5' 5'- AGATCT - 3" 3'- ТСТАGA -5' 5- GATC - 3 3- CTAG - 3' You plan to ligate DNA from two different sources. The target DNA is digested with BamHI, and the insert DNA is digested with Bg/II, and the resulting fragments mixed and incubated with DNA ligase. Target DNA: Insert DNA: 5 .....ACCAGTAGGATCCGATGCGT... 5 CGTAGATCTACCGTACGTGCTACGAGATCTGGC 3' .TGGTCATCCTAGGCTACGCA... 31 GCATCTAGATGGCATGCACGATGCTCTAGACCG a) What type of overhang is generated by these three enzymes? b) Write out the sequence (in double-stranded format) of the longest insert fragment that will results after BglII digestion, ensure the nature of the overhangs is clear. 1 c) What is the function of the DNA ligase enzyme? Write out the sequence (in double-stranded format) of the ligation product, with the insert fragment joined into the BamHI site of the target DNA. Use black for target sequences, and blue for insert sequences. Assume the ligation reaction was successful and you have generated a recombinant DNA e) molecule. Which of the three enzymes listed above can be used to excise the insert DNA from the target? Motivate your answer.
Expert Answer:
Answer rating: 100% (QA)
3 a The type of overhang generated from the above restriction enzymes will be of the staggered type ... View the full answer
Related Book For
Posted Date:
Students also viewed these biology questions
-
The figure below shows the production possibilities frontiers (PPFs) for Italy and India for their domestic production of olives and tea. Without trade, assume that each is consuming olives and tea...
-
The figure below shows the one-year return distribution for RCS stock. Calculate a. The expected return. b. The standard deviation of thereturn. 35 30 25 20 15F 2 10 -25% -10% 0% 10% 25% Return
-
The figure below shows a scheme for testing hydrocarbon compounds to determine whether they are saturated or unsaturated. Draw the scheme and complete it by filling in the missing words related to...
-
What are the concepts of traditional and contemporary organizational design? Will these designs be influenced differently by management and the environment?
-
Not all the items in your office supply store are evenly distributed as far as demand is concerned, so you decide to forecast demand to help plan your stock. Past data for legal-sized yellow tablets...
-
Every candle maker in Town A must have a license. The cost of a license is the same regardless of the number of candles a business produces. a. Assuming that the candle market is perfectly...
-
Cedric Salos is considering different ways to raise money for the expansion of his company's operations. Cedric is not sure about the advantages of issuing bonds versus issuing common stock. In...
-
Solve the following LP problem using the corner point graphical method. At the optimal solution, calculate the slack for eachconstraint: Maximize profit = 4X + 4Y subject to
-
The Warrenburg Antique Mall budgeted credit sales in the first quarter of 2024 to be as shown. Credit sales in December 2023 are expected to be $200,000. The company expects to collect 70 percent of...
-
Practice reading a graph. These questions all refer to Figure 1.1. (a) What fraction of days have a daily high temperature of 28C during the 1970s and the 2010s? (b) For the 1970s and 2010s, what is...
-
An investment is expected to generate cash flows of $20000 next year (at time t=1), and $10000 in two years at time t=2. After that, the annual cash flows generated by the investment will decrease...
-
What is an environmental scan and why is it important? How does the environmental scan impact the marketing plan? Next, read the article "Apple Signals Coronavirus's Threat to Global Business". How...
-
Sandy and Brian Scott contracted with Kitchen Renovations (Based in CA) for the complete upgrade of the kitchen of their beach house. Sandy wanted certain features in the kitchen, including a JennAir...
-
If logrolling is bad legislating such that the practice should be limited by single-subject rules. The question also asks whether a consequence of single-subject rules is to make it more difficult...
-
Write a summary in 300 words describing the three takeaways or key elements from one of the following research tutorial videos: MarketLine - Country Profile with PESTEL Analysis...
-
Some sports and levels of those sports are more complicated than others, so let's use a simple example.Let's assume that the ratio of the force on shoe soles to the weight of a female runner is...
-
Activity 1: [Weightage: 20%] Write a program that keeps taking input from the user until the user enters -1 and display the following statistics at the end. Write separate method for each...
-
Wal-Mart is the second largest retailer in the world. The data file on the disk holds monthly data on Wal-Marts revenue, along with several possibly related economic variables. a) Using computer...
-
The Economist commented on the Greek debt crisis in an aptly titled article on February 11, 2012, Brinkmanship in Athens, as Greece led the European economy to the edge as a battle brewed between...
-
The following figure shows the supply and demand for strawberries. Answer the questions that follow. Supply and Demand of Strawberries a. Indicate the equilibrium price and equilibrium quantity. b....
-
How do sticky wages and prices make monetary policy effective in the short run?
-
Which of the following is potentially a barrier to entry into a product market? a. patent protection on the design of the product b. economies of scale in the product market c. government licensing...
-
How do we know whether the monopolist is making a profit?
-
How does the monopolist decide what output to produce?
Study smarter with the SolutionInn App