The income statement approach to estimating uncollectable accounts is used by Smith Brothers. On January 31,...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
The income statement approach to estimating uncollectable accounts is used by Smith Brothers. On January 31, 2015 the Allowance for Doubtful Accounts had a credit balance of $5 250. It is estimated that 1% of the $2 250 000 of net credit sales made during January will be uncollectable. This estimate was entered in the accounts by an adjusting entry on January 31. On February 12, an account receivable from Carlotta Smith of $4 125 was determined to be worthless and was written off. However, on February 24, Smith won several million dollars in the lottery and she indicated that she would pay her $4 125 past-due account. On March 27 she paid off the entire $4 125 balance with cash. a) Prepare journal entries for Jan. 31, Feb. 12, Feb. 24 and Mar. 27. 5. Sunshine Office Products Sunshine Office has the following aging schedule on for their $345 250 accounts receivable: Total Not Yet Due = $183 590 1-30 days past due = $94 680 31-60 days past due = $43 340 61-90 days past due = $9 000 Over 90 days past due = $14 640. All accounts are due in 30 days and after this are considered past due. Two accounts receivable were accidentally omitted from this schedule. The following data is available regarding these accounts: 1. R. Jones owes $4 250 from two invoices: invoice #218 dated March 14 in the amount of $2 980; and invoice # 568 dated May 9 in the amount of $1 270. 2. F. Smith owes $3 760 from two invoices: invoice # 574 dated May 19, in the amount of $1 350: and invoice # 641 dated June 5 in the amount of $2 410. a) Complete the aging chart as of June 30 by adding to the column subtotals an aging of the accounts of Jones and Smith. b) Calculate the estimated portion of each age group that will prove uncollectable and the required balance in the Allowance for Doubtful Accounts. The following percentages of each age group are estimated to be uncollectable: 1% for amount not yet due; 4% for 1-30 days past due; 10% for 31- 60 days past due; 30% for 61-90 days past due; 50% for over 90 days past due. c) Prepare the journal entry to adjust the Allowance for Doubtful Accounts account at June 30, 2015. Prior to making this adjustment, the account has a credit balance of $13 800. 6. West Side Restaurant Journalize the following three transactions for West Side Restaurant on November 3, 2015: a) A lunch bill for $34.00 was paid with a debit card that has fees of $0.10 per transaction. b) A lunch bill for $25.00 was paid with a MasterCard that has fees of 3%. c) A lunch bill for $55.00 was paid with American Express that has fees of 3.5%. 7. De Boer Jewellers De Boer Jewellers is a jewellery wholesaler. Joe's Fine Jewellery has owed De Boer Jewellers $9 750 for over three months so on March 30 De Boer Jewellers accepts a promissory note for the total amount, with 5% annual interest for a term of three months ending June 30, 2015. Record the following independent journal entries: a) The journal entry to record the acceptance of the note by De Boer Jewellers on March 30, 2015. b) The journal entry to record the receipt of payment of the note, plus interest, on June 30, 2015. c) The journal entry to record the failure of Joe's Fine Jewellery to pay their note, on June 30, 2015. The income statement approach to estimating uncollectable accounts is used by Smith Brothers. On January 31, 2015 the Allowance for Doubtful Accounts had a credit balance of $5 250. It is estimated that 1% of the $2 250 000 of net credit sales made during January will be uncollectable. This estimate was entered in the accounts by an adjusting entry on January 31. On February 12, an account receivable from Carlotta Smith of $4 125 was determined to be worthless and was written off. However, on February 24, Smith won several million dollars in the lottery and she indicated that she would pay her $4 125 past-due account. On March 27 she paid off the entire $4 125 balance with cash. a) Prepare journal entries for Jan. 31, Feb. 12, Feb. 24 and Mar. 27. 5. Sunshine Office Products Sunshine Office has the following aging schedule on for their $345 250 accounts receivable: Total Not Yet Due = $183 590 1-30 days past due = $94 680 31-60 days past due = $43 340 61-90 days past due = $9 000 Over 90 days past due = $14 640. All accounts are due in 30 days and after this are considered past due. Two accounts receivable were accidentally omitted from this schedule. The following data is available regarding these accounts: 1. R. Jones owes $4 250 from two invoices: invoice #218 dated March 14 in the amount of $2 980; and invoice # 568 dated May 9 in the amount of $1 270. 2. F. Smith owes $3 760 from two invoices: invoice # 574 dated May 19, in the amount of $1 350: and invoice # 641 dated June 5 in the amount of $2 410. a) Complete the aging chart as of June 30 by adding to the column subtotals an aging of the accounts of Jones and Smith. b) Calculate the estimated portion of each age group that will prove uncollectable and the required balance in the Allowance for Doubtful Accounts. The following percentages of each age group are estimated to be uncollectable: 1% for amount not yet due; 4% for 1-30 days past due; 10% for 31- 60 days past due; 30% for 61-90 days past due; 50% for over 90 days past due. c) Prepare the journal entry to adjust the Allowance for Doubtful Accounts account at June 30, 2015. Prior to making this adjustment, the account has a credit balance of $13 800. 6. West Side Restaurant Journalize the following three transactions for West Side Restaurant on November 3, 2015: a) A lunch bill for $34.00 was paid with a debit card that has fees of $0.10 per transaction. b) A lunch bill for $25.00 was paid with a MasterCard that has fees of 3%. c) A lunch bill for $55.00 was paid with American Express that has fees of 3.5%. 7. De Boer Jewellers De Boer Jewellers is a jewellery wholesaler. Joe's Fine Jewellery has owed De Boer Jewellers $9 750 for over three months so on March 30 De Boer Jewellers accepts a promissory note for the total amount, with 5% annual interest for a term of three months ending June 30, 2015. Record the following independent journal entries: a) The journal entry to record the acceptance of the note by De Boer Jewellers on March 30, 2015. b) The journal entry to record the receipt of payment of the note, plus interest, on June 30, 2015. c) The journal entry to record the failure of Joe's Fine Jewellery to pay their note, on June 30, 2015.
Expert Answer:
Related Book For
Financial and Managerial Accounting the basis for business decisions
ISBN: 978-1259692406
18th edition
Authors: Jan Williams, Susan Haka, Mark Bettner, Joseph Carcello
Posted Date:
Students also viewed these accounting questions
-
When referring to fee-based, managed accounts, what does the term discretionary mean? Question 30 options: The advisor communicates with their client only when he/she wants to do so The advisor may...
-
In 2012 Craig Gonzales opened Craigs Pets, a small retail shop selling pet supplies. On December 31, 2012, Craigs accounting records showed the following: Inventory on December 31,2012..$10,100...
-
The Cormier Corporation sells office equipment and supplies to many organizations in the city and surrounding area on contract terms of 2/10, n/30. In the past, over 75% of the credit customers have...
-
The cost formula for the maintenance department of Rainbow, Ltd., is $19,400 per month plus $7,70 per machine hour used by the production department. Required: a. Calculate the maintenance cost that...
-
In a study of the psychosocial changes in individuals who participated in a community-based intervention program, individuals who were clinically identified as hypertensives were randomly assigned to...
-
Write the amino-acid sequence obtained from left-toright translation of the messenger RNA sequence. AUUGGCGCGAGAUCGAAUGAGCCCAGU
-
Explain why it would be virtually impossible to set an exchange rate between the Japanese yen and the U.S. dollar and to maintain a fixed exchange rate.
-
Manzer Enterprises produces premier raspberry jam. Output is measured in pints. Manzer uses the weighted average method. During January, Manzer had the following production data: Units in process,...
-
c) Assume that you find that the two last years Yt-2 and Yt-1 should be chosen to forecast Yt. If the last period is T, how would you go about forecasting Y+1|T, Y+2|T and Y+3|r, giving a step by...
-
On January 1, 2021, Surreal Manufacturing issued 540 bonds, each with a face value of $1,000, a stated interest rate of 3 percent paid annually on December 31, and a maturity date of December 31,...
-
Madeline Manufacturing Inc. s current stock price is $ 4 0 per share. Call options for this stock exist that permit the holder to purchase one share at an exercise price of $ 3 0 . These options...
-
Analyzing a company for its investment potential In its annual report, WRM Athletic Supply, Inc. includes the following five-year financial summary: WRM ATHLETIC SUPPLY, INC. Five-Year Financial...
-
RFP to Determine Consumers' Perceptions of Purchasing Multi-Purpose Cleansing and Facial Device The use of skincare devices is on the rise, although only a few Canadians have enjoyed the experience...
-
Marie passes by Cody's property every day to get to work. On a hot summer day while Marie was walking back from work, she noticed that Cody's lawn sprinkler was on. Wanting to cool down a bit, Marie...
-
Janes Company providedthe following information on intangible assets: A patent was purchased from the Lou Company for $1,100,000 onJanuary 1, 2016. Janes estimated the remaining useful life of...
-
ts Before 226 After 203 213 194 207 194 185 172 202 195 197 179 242 232 189 191 Print Done This Subn ew weight-loss program claims that participants will lose an average of more than 10 pounds after...
-
During the year land was revalued and the surplus reported as Revaluation surplus; and an asset costing 80,000, written down to 38,000, was sold for 40,000. Identify the cost of any non-current...
-
Given your answers to Questions 8 and 9, how do you explain the existence of convertible bonds?
-
Show that if managers think their companys shares are overvalued, there is a better product to issue than a convertible bond.
-
Show that if managers think their companys shares are undervalued, there is a better product to issue than a convertible bond.
Study smarter with the SolutionInn App