List the six most important trends of the general environment. Give a hypothetical example of a way
Question:
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 57% (14 reviews)
The six general trends are economic trends sociocultural trends politicallegal trend...View the full answer
Answered By
Muhammad Haroon
More than 3 years experience in teaching undergraduate and graduate level courses which includes Object Oriented Programming, Data Structures, Algorithms, Database Systems, Theory of Automata, Theory of Computation, Database Administration, Web Technologies etc.
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Small Business Management Launching & Growing Entrepreneurial Ventures
ISBN: 978-1133947752
17th edition
Authors: Justin Longenecker, William Petty, Leslie Palich, Frank Hoy
Question Posted:
Students also viewed these Management Leadership questions
-
List the six most important trends of the general environment. What are some ways in which each trend might affect a small business?
-
Give a hypothetical example where Company A buys Company B for a 15.0% premium.
-
Give a hypothetical example where Company A buys Company B for a 15.0% discount.
-
Stuart and Belinda, who earn good salaries, want to buy a property they can use to live in and operate a bed and breakfast in their retirement. The only funds they have available is their combined...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Find the positive square root of 18 using the false-position method to within s = 0.5%. Employ initial guesses of xl = 4 and xu = 5.
-
During 2016, The Alberta Oil & Gas Company began an exploration project in Montana. The company had paid \($500,000\) for the drilling rights on a tract of 500 acres of land. The company then spent...
-
A partner in the national accounting firm mentioned in the previous questions does not believe that the time estimates for each activity can be specified with certainty. Instead, she prefers to...
-
1.Describe what characteristics of the house you have taken into consideration for your network (e.g., how many bedrooms, floors, etc.) * Your house must minimally include two floors and six rooms....
-
Amber Companys assets total $150,000 and its liabilities total $85,000. What is the amount of Ambers retained earnings if its capital stock amounts to $50,000?
-
List and describe the 10 approaches outlined in this chapter that can be used to generate creative new business ideas. What are the most important features of each of these?
-
What are the primary factors that shape competition in an industry, according to Porters model? In your opinion, which of these factors will have the greatest impact on industry prices and profits?
-
Computer upgrades have a nominal time of 80 minutes. Samples of five observations each have been taken, and the results are as listed. Using factors from table, determine upper and lower control...
-
A tennis player moves in a straight-line path as shown in the figure below. Find her average velocity in the following time intervals. x (m) 4 2 (a) 0 to 1.0 s t(s) 2 3 4 5 m/s (b) 0 to 4.0 s m/s (c)...
-
Convert this formula to linear for y=mx+c = Eg 2kT
-
You are an assistant to Blake Harper, a partner in Parma Disaster Recovery in Atlanta, Georgia. The firm offers training and consulting services to companies that want to prepare for or recover from...
-
Discuss appropriate management of diversity, and how it can help in the areas of cost, acquisition, resources, marketing, creativity, problem solving, and flexibility?
-
Equation 4 --> I^2 = (bg/a uo n L) m fixed data: Fixed Data: [mg/cm] 4.38 l [cm] 14.8 N [turns] 550 n [m-1] 37.16216 a [cm] 8.4 b [cm] 8.5 L [cm] 2.2 slope = y = 96364 + 3^-15 calculate the...
-
An oxidationreduction reaction occurs when a stream of hydrogen gas is passed over hot copper(II) sulfide. Indicate each of the following for the above redox reaction: (a) Substance oxidized (b)...
-
Fill in each blank so that the resulting statement is true. 83 + 103 = ______ .
-
Explain how the Hausman-Taylor estimator can be used to obtain consistent estimates of coefficients of time-invariant variables in a random effects model.
-
Name a company that seems large but might be classified as small because it has relatively little impact on its industry.
-
Large businesses depend on small businesses. Why?
-
Define outsourcing, and describe its impact on small business.
-
Build a cash flow table as given below using Microsoft Excel when all dollar values are in thousands. Make sure appropriate equations are used to calculate PVs and add all PVs to find NPV. Table 1...
-
During the audit of the dividends declared and paid account, what is one procedure the auditor can perform to verify the accuracy of the ($) amount paid. (3 marks) Question 31 options: Compare the...
-
Your parents gave you $41,000 worth of Apple stock in 2014. In 2016, the shares are worth $66,000. (The gift tax annual exclusion is $28,000 for 2014 and 2016.) b. By what amount was your parents'...
Study smarter with the SolutionInn App