What are some of the ethical issues associated with using regression to predict individuals future behavior?
Question:
What are some of the ethical issues associated with using regression to predict individuals’ future behavior?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 83% (12 reviews)
Two business scenarios modified from Glover Bumpus Logan and Seasla were used to assess ethical inte...View the full answer
Answered By
Ifsha akhlaq
I have different types of experiences in different departments such as I have 2 years of experience as a hospital pharmacist. I have 4 years of experience as a quality control manager and research officer in a nutraceutical industry. I have tutoring experience of 7 years in a college and online teaching.
0.00
0 Reviews
10+ Question Solved
Related Book For
Statistics For The Behavioral Sciences
ISBN: 9781319190743
5th Edition
Authors: Susan A. Nolan, Thomas Heinzen
Question Posted:
Students also viewed these Business questions
-
What are some of the ethical issues that arise when a firm becomes overly zealous in advertising its products?
-
What are some of the ethical issues that may arise from a firms procurement activities? Are you aware of any of these issues from your personal experience or businesses you are familiar with?
-
What are some of the ethical issues involved in cross-cultural marketing?
-
What is true about business cycles? Multiple select question. They vary in duration and intensity. They follow an identical pattern. They are made up of alternating rises and declines. "Ups" are...
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Ski Powder Resort ends its fiscal year on April 30. The business adjusts its accounts monthly, but closes them only at year-end (April 30). The resorts busy season is from December 1 through March...
-
Alberts Trip to Canada. Albert visits Toronto and buys 1.74 Canadian dollars (CAD) for one British pound (GBP). When he returns home to the U.K., he converts CAD1 into GBP0.59. Is the new exchange...
-
The adjusted trial balance of Sang Company shows the following data pertaining to sales at the end of its fiscal year October 31, 2017: Sales Revenue $820,000, Freight-Out $16,000, Sales Returns and...
-
XYZ Corporation is considering two investment opportunities, Investment X and Investment Y, with the following details: Investment X: Cost of Capital - 8%, Initial Investment - $150,000, Cash Inflow...
-
Network Solutions, Inc." is a worldwide leader in hardware, Network Solutions and by encouraging all senior leaders to software, and services essential to computer networking. Until ensure that those...
-
In what ways have regression tools been used to predict individuals future behavior?
-
A meta-analysis found a negative correlation between birth weight and blood pressure later in life (Mu et al., 2012). a. Explain what is meant by a negative correlation between these two variables....
-
Solve graphically. Round solutions to three decimal places, where appropriate. 7x 2 - 43x + 6 = 0
-
Fill in the Blank. If \(S(\overline{\omega)}\) has significant values over a wide range of frequencies, the process is called \(\mathrm{a}(\mathrm{n})\) _____________ process.
-
Verify that the following equation exhibits chaotic behavior: \[x_{n+1}=k x_{n}\left(1-x_{n} ight)\]
-
Fill in the Blank. The standard deviation is the positive square root of ___________ .
-
True or False. A random variable is a quantity whose magnitude cannot be predicated precisely.
-
Fill in the Blank. If \(S(\overline{\omega) \text { has }}\) significant values only over a small range of frequencies, the process is called \(\mathrm{a}(\mathrm{n})\) _____________ process.
-
Examine the major effects that government policies have on production and employment. Predict the potential effects that government policies could have on your company.
-
Inexhaustible collections of ONPOs are not required to be capitalized or depreciated, if certain criteria are met. Why is this so, and what accounting and reporting recognition, if any, is required...
-
Why would you think that it would be wise to include Gender in that regression?
-
Since you have the DASL data on brain size, note that it also includes the variables of height and weight. Predict weight from height and sex and compare with the answer for Exercise 11.17.
-
In examples like the Guber study on the funding of education, we frequently speak of variables like PctSAT as nuisance variables. In what sense is that usage reasonable here, and in what sense is it...
-
s CB1(1) and YA1 of the Income Tax Act 2007 are very important because: Question 5Answer a. these sections explain how an employee, sole trader, partnership, trust and company should be treated...
-
If the seller is responsible for the shipping costs of merchandise sold, the shipping terms will be specified as:Multiple choice question.FOB destinationFOB factoryFOB shipping pointFOB start
-
A golf club production company wants to ensure that all aspects of its production and distribution processes are operating at optimal efficiency. The company produces three types of clubs, a line for...
Study smarter with the SolutionInn App