Question: A 0.01 M solution of a weak acid in water is 0.05% ionized at 25C. What is its pK?

A 0.01 M solution of a weak acid in water is 0.05% ionized at 25°C. What is its pK?

Step by Step Solution

★★★★★

3.43 Rating (169 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock

The equilibrium constant for a weak acid is K H A HA The c... View full answer

blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Document Format (1 attachment)

Word file Icon

930-M-S-B-C (924).docx

120 KBs Word File

Students Have Also Explored These Related Biochemistry Questions!

Q:

Mathematical Show that, for a pure weak acid in water, pH 5 (pKa 2log [HA])/2.

Q:

A 0.108 Msample of a weak acid is 4.16% ionized in solution. What is the hydroxide concentration of this solution?

Q:

A 0.010 M solution of ammonia, NH3, has a pH of 10.6 at 25C. What is the concentration of hydroxide ion?

Q:

Read the information and work out the number of Hcl added (mol) for buffers 1 and 2. Please make sure the unrounded answer is 5 or more significant figures work out the ph work out the buffer...

Q:

I am having trouble grasping the material. Please help explain each. {We breathe out CO2 gas. In our blood CO2 is present as carbonic acid which has a pka of 6.36.) 1. Using Lewis structures draw the...

Q:

26. Non-ionic crystals such as metals or quartz are soluble in water. Is this statement true or false? a. True b. False (2 marks) 27. Acid and base are common reagents used in hydrometallurgy. Which...

Q:

Calculate the volume of 1 M solution of HCl needed for 1 unit shift of the pH of the following solutions: a. 100 mL of 0.01 M solution of weak acid (pKa = 6) and 0.05 M of it's sodium salt b. 0.005...

Q:

The pHof 0.01 M aqueous solution of a weak acid if HA is 4. The PK, value of the acid at 25 is Backspace 7| 89 4 5 6 1 2 3

Q:

Consider the following three statements (I, II, and III). I. NH4+is a polyatomic ion and acts as a weak acid in water. II. NH3 is a conjugate base of NH4+. III. When you dissolve NH4Cl in water, the...

Q:

The bottom right corner for this picture below is the results for Part 2 of the experiment. All I need is the discussion. Experiment \#3 Absorbance Spectra, pKa and concentration of p-Nitrophenol...

Q:

The program will simulate spinning a wheel that has been numbered 1 through 16. Not only is the wheel numbered, but it also has colors and a designated jackpot value. Each time the wheel spun, the...

Q:

Acme, Inc., supplies rocket ships to the retail market and hires workers to assemble the components. A rocket ship sells for $30,000, and Acme can buy the components for each rocket ship for $25,000....

Q:

5. The tax multiplier increases in magnitude when A. the MPS increases. B. the spending multiplier falls. C. the MPC increases. D. government spending increases. E. taxes increase. 6. Which of the...

Q:

List the errors in the following graph. Carefully explain why the curves drawn this way are wrong. In other words, why cant these curves be as they are shown in the graph? Cost (per unit) AFC AVC 0...

Q:

Indicate the ionic species of ammonia that predominates at pH 4, 8, and 11.

Q:

Describe the outcome of a chain-terminator sequencing procedure in which (a) Too few primers are present (b) An excess of primers is present

Q:

Write the sequences of the two 12-residue primers that could be used to amplify the following DNA segment by PCR. ATAGGCATAGGCCCATATGGCATA AGGCTTTATAATAT- GCGATAGGCGCTGGTCAG

Q:

A USDJPY (Daily, #300) Product Settings Chart Type Time Scale Studies Draw/View *** QQ USDJPY (Daily, #300) 04/13/2022 H:126 307 L:125.334 O:125.348 C:125.650 MACD 12,26,9 MACD 2.0207 Signal 1.8847...

Q:

html sample solution

Q:

Let S = $85, K =$80,r=8% (continuously compounded), T -0.5, and 8-0. Letu -1.3,0 -0.75, and n-1. Calculate the value of a European call if A-0.652406 and B = -39.9601 a $11.001 b. $18.903 OC $15.494...