A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe
Question:
A safe is loaded onto a truck whose bed is 5.50 ft above the ground. The safe weighs 538 lb.
(a) If the effort applied is 140 lb, what length of ramp is needed?
(b) What is the MA of the inclined plane?
(c) Another safe weighing 257 lb is loaded onto the same truck. If the ramp is 21.1 ft long, what effort is needed?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 78% (14 reviews)
a Length F R heightF E 538 lb 550 ...View the full answer
Answered By
Charles mwangi
I am a postgraduate in chemistry (Industrial chemistry with management),with writing experience for more than 3 years.I have specialized in content development,questions,term papers and assignments.Majoring in chemistry,information science,management,human resource management,accounting,business law,marketing,psychology,excl expert ,education and engineering.I have tutored in other different platforms where my DNA includes three key aspects i.e,quality papers,timely and free from any academic malpractices.I frequently engage clients in each and every step to ensure quality service delivery.This is to ensure sustainability of the tutoring aspects as well as the credibility of the platform.
4.30+
2+ Reviews
10+ Question Solved
Related Book For
Applied Physics
ISBN: 978-0132109277
10th Edition
Authors: Dale ewen, Neill schurter, P. erik gundersen
Question Posted:
Students also viewed these Mechanics questions
-
A kite 100 ft above the ground moves horizontally at a speed of 8 ft/s. At what rate is the angle between the string and the horizontal decreasing when 200 ft of string have been let out?
-
A batter hits a baseball 3 ft above the ground toward the center field fence, which is 10 ft high and 400 ft from home plate. The ball leaves the bat with speed 115 ft/s at an angle 508 above the...
-
A hot-air balloon is 150 ft above the ground when a motorcycle (traveling in a straight line on a horizontal road) passes directly beneath it going 40 mi/hr (58.67 ft/s). If the balloon rises...
-
Using the information for Sarot, Inc., in SE 4 and SE 5, compute the current ratio, quick ratio, receivable turnover, days sales uncollected, inventory turnover, days inventory on hand, payables...
-
What peptide would be synthesized from the following DNA sequence? 5TTACCGACTGGTCACTCCCAT3
-
Which do you prefer : a bank account that pays 4.5% per year (EAR) for three years or a) An account that pays 2.5% every 6 months for three years? b) An account that pays 6.5% every 18 months for...
-
Explain methods for controlling stakeholder engagement? LO.1
-
You are the manager of the examination engagement of the financial projection of Honeys Health Foods as of December 31, 2013, and for the year then ended. The audit senior, Currie, has prepared the...
-
Imagine you are offered a lump sum payment of $15000 today (Option 1) or $19000 at the end of five years (Option 2) or $25000 at the end of seven years (Option 3), the appropriate interest rate is...
-
The Champion Chip Company produces three grades of computer chips from a joint process: deluxe, superior, and good. Although the chips are manufactured in plants in several international locations,...
-
An inclined plane is 10.0 m long and 2.50 m high. (a) Find its mechanical advantage. (b) A resistance of 727 N is pushed up the plane. What effort is needed? (c) An effort of 200 N is applied to push...
-
1. A 3.00-m-long plank is used to raise a cooling unit 1.00 m. What is the MA of the ramp made by the plank? 2. A 2.75-m-long board is used to slide a compressor a vertical distance of 0.750 m. What...
-
Minicase 3 Boeing vs. McDonnell Douglas Boeing and McDonnell Douglas are two leaders in the manufacture of aircraft. In 1996 Boeing announced intentions to acquire McDonnell Douglas and create one...
-
5.Descibe the HSI color image model 6. Describe the basic relationship between the pixels
-
1. What is the need for transform? 2. What is Image Transform? 3. What are the applications of transform? 4. Give the Conditions for perfect transform . 5. What are the properties of unitary...
-
6. Define Fourier transform pair 7. Define Fourier spectrum and spectral density 8. Give the relation for 1-D discrete Fourier transform pair 9. Specify the properties of 2D Fourier transform. 10....
-
16. What is wrap around error? 17. Give the formula for correlation of 1D continuous function. 18. What are the properties of Haar transform. 19. What are the Properties of Slant transform 20....
-
21. Define fast Walsh transform. 22. Give the relation for 1-D DCT. 23. Write slant transform matrix SN. 24. Define Haar transform. 25. Define K-L transform. 26. Give the equation for singular value...
-
(Appendix) Amber Company produces custom framing. For one job, the trainee assigned to cut the mat entered the mat dimensions incorrectly into the computer. The mat was unusable and had to be...
-
The National Collegiate Athletic Association (NCAA) and the National Federation of State High School Associations (NFHS) set a new standard for non-wood baseball bats. Their goal was to ensure that...
-
What risks do alliances pose to partner firms?
-
A man wearing ice skates throws and 8-kg block with an initial velocity of 2 m/s, measured relative to himself, in the direction shown. If he is originally at rest and completes the throw in 1.5 s...
-
The barge weighs 45 000 lb and supports two automobiles A and B which weigh 4000 lb and 3000 lb, respectively, if the automobiles start from rest and drive towards each other, accelerating at BA = 4...
-
The barge B weighs 30 000 lb and supports and automobile weighing 3000 lb. if the barge is not tied to the pier P and someone drives the automobile to the other side of the barge for unloading...
-
A person purchased a $181,873 home 10 years ago by paying 20% down and signing a 30-year mortgage at 8.4% compounded monthly. Interest rates have dropped and the owner wants to refinance the unpaid...
-
3 . Accounting.. How does depreciation impact financial statements, and what are the different methods of depreciation?
-
NEED THIS EXCEL TABLE ASAP PLEASE!!!! Presupuesto Operacional y C lculo del COGS Ventas Proyectadas: Ventas Proyectadas: $ 4 5 0 , 0 0 0 Precio por unidad: $ 4 5 0 Unidades vendidas: 4 5 0 , 0 0 0 4...
Study smarter with the SolutionInn App