A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with

Question:

A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with constant velocity. If the sprinter’s time for the first 130 m is 25 s, determine
(a) His acceleration,
(b) His final velocity,
(c) His time for the race.

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Vector Mechanics for Engineers Statics and Dynamics

ISBN: 978-0073212227

8th Edition

Authors: Ferdinand Beer, E. Russell Johnston, Jr., Elliot Eisenberg, William Clausen, David Mazurek, Phillip Cornwell

See More Books

Question Posted: Oct 18, 2010 07:17 AM

See More Questions

A sprinter accelerates from rest to 9.00 m / s in 1.38 s. What is her acceleration in (a) m / s2; (b) km / h2?
A sprinter of mass 65.0 kg starts his race by pushing horizontally backward on the starting blocks with a force of 200 N. (a) What force causes him to accelerate out of the blocks: (1) his push on...
A car accelerates from 14 m / s to 21 m / s in 6.0 s. What was its acceleration? How far did it travel in this time? Assume constant acceleration.
A. What is Alpha One's NOPAT? Why does NOPAT differ from the earnings after taxes? B. Estimate the effective before-tax cost of the long-term debt. c. Estimate the effective after-tax cost of the...
With the advent of managed care, U.S. hospitals have begun to operate like businesses. More than ever before, hospital administrators need to know and apply the theories and methods taught in...
Consider an entity type SECTION in a UNIVERSITY database, which describes the section offerings of courses. The attributes of SECTION are SectionNumber, Semester, Year, CourseNumber, Instructor,...
4. Should the project members approach Ivana about her management style? If so, how?
The eight general audit procedures produce evidence about the principal management assertions in financial statements. However, some procedures are useful for producing evidence about certain...
Exercise 12-8 Cash flows from investinf activities LO P3 Check my work 7 Exercise 12-8 Cash flows from investing activities LO P3 a. Equipment with a book value of $79,500 and an original cost of...
Christine Phillips is in charge of planning and coordinating next springs sales management training program for her company. Christine has listed the following activity information for this project:...
Steep safety ramps are built beside mountain highways to enable vehicles with defective brakes to stop safely. A truck enters a 750-ft ramp at a high speed v0 and travels 540 ft in 6 s at constant...
A group of students launches a model rocket in the vertical direction. Based on tracking data, they determine that the altitude of the rocket was 27.5 m at the end of the powered portion of the...
A 70-kg skier starts from rest at point A and skis down the slope shown. Neglecting friction, determine the force exerted on the skier by the snow (a) Just before the skier reaches B, (b) Immediately...
The following information about the payroll for the week ended December 30 was obtained from the records of Saine Co.: Salaries: Sales salaries Deductions: $180,000 Income tax withheld $65,296...
You have just been hired as the chief executive officer (CEO) in a medium-sized organization. The organization is not suffering financially, but neither is it doing as well as it could do. This is...
The following is the selling price and cost information about three joint products: X Y Z Anticipated production 1 2 , 0 0 0 lbs . 8 , 0 0 0 lbs . 7 , 0 0 0 lbs . Selling price / lb . at split - off...
calculate the maximum bending compressive stress of the following section under NEGATIVE bending moment of 216KN.m. 216mm 416mm 316mm 115mm
Need assistance with the following forms: 1040 Schedule 1 Schedule 2 Schedule C Schedule SE Form 4562 Form 8995 Appendix B, CP B-3 Christian Everland (SS number 412-34-5670) is single and resides at...
Describe ways to design compensation contracts that minimize manager-shareholder incentive problems. AppendixLO1
The polar coordinates of a point are given. Find the rectangular coordinates of the point. (-1, - /3)
The 5 sequence for the mRNA for E. coli ribosomal L10 protein is shown below. Identify the ShineDalgarno sequence and the initiator codon. 5CUACCAGGAGCAAAGCUAAUGGCUUUA3
A cryogenic fluid as liquid nitrogen at 90 K, 400 kPa flows into a probe used in cryogenic surgery. In the return line the nitrogen is then at 160 K, 400 kPa. Find the specific heat transfer to the...
A small stream with 20oC water runs out over a cliff creating a 100 m tall waterfall. Estimate the downstream temperature when you neglect the horizontal flow velocities upstream and downstream from...
A small water pump is used in an irrigation system. The pump takes water in from a river at 10oC, 100 kPa at a rate of 5 kg/s. The exit line enters a pipe that goes up to an elevation 20 m above the...
Milano Pizza is a small neighborhood pizzeria that has a small area for in-store dining as well as offering take-out and free home delivery services. The pizzerias owner has determined that the shop...
Which of the following statement regarding a post-closing trial balance is not true
What are the benefits and potential risks factors for undertaking derivative strategies compared to cash transactions

A sprinter in a 400-m race accelerates uniformly for the first 130 m and then runs with

Question:

Step by Step Answer:

a During the acceleration phase x x vot at Using xo 0 and vo 0 and solving fo...View the full answer

Vector Mechanics for Engineers Statics and Dynamics

Students also viewed these Mechanical Engineering questions