Consider the following diagram of a small open economy: a) Calculate net exports and the capital outflow

Question:

Consider the following diagram of a small open economy:

a) Calculate net exports and the capital outflow when the world real interest rate is 7%.

b) Calculate net exports and the capital outflow when the world real interest rate is 5%.

image text in transcribed

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Macroeconomics Policy And Practice

ISBN: 978-0133424317

2nd Edition

Authors: Frederic Mishkin

See More Books

Question Posted: Feb 17, 2024 11:01 PM

See More Questions

Use the properties of logarithms to express each logarithm as a sum or difference of logarithms, or as a single logarithm if possible. Assume that all variables represent positive real numbers. log4...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
The population of salmon next year is given by f(S) = Ser(1 - S/P), where S is this year's salmon population, P is the equilibrium population, and r is a constant that depends upon how fast the...
Selected data on merchandise inventory, purchases, and sales for Jaffe Co. and Coronado Co. are as follows: Instructions 1. Determine the estimated cost of the merchandise inventory of Jaffe Co. on...
Northcutt Bikes purchases two types of wheels for their road racing bikes: a regular version and a deluxe version. The table below has demand information for the past year for each style of wheel, as...
Youflywithme.com reports the following income statement information for the current year All sales result from principal agent transactions Compare the financial statement presentation under the...
Evaluate various private and governmental sources that assist consumers with debt problems.
On January 1, 2010, Furball Company had Accounts Receivable $98,000 and Allowance for Doubtful Accounts $8,100. Furball Company prepares financial statements annually. During the year the following...
Paulis Kennel uses tenant-days as its measure of activity, an animal housed in the kennel for one day is counted as one tenant-day. During February, the kennel budgeted for 4,600 tenant-days, but its...
Consider a small open economy that is currently running a trade surplus. Answer the following questions using a graphical representation of desired saving and investment in the small open economy: a)...
Suppose Japan has a GDP of $5 trillion, and that its national savings rate is 25%. Assuming Japan is an open economy, a) calculate Japans investment if net exports are 1% of GDP. b) calculate Japans...
Approximate the point(s) of intersection of the pair of equations. a. 2.3x + 3.8y = 12.4, y = 1.1 ln 1x - 2.052 b. y = ln 3x, y = 3x - 8 c. y = 2.3 ln 1x + 10.72, y = 10e-0.007(x)2 [4 4 2
The break even point of a company is $240 000. They sell their product at a markup of 30% and have variable expenses of 9% of sales. They currently make a profit of $10 500. They plan on reducing...
What kind of messages are young girls and boys receiving about whether their safety in relationships is valued are by their families and communities? Do we emphasize to our children (boys and girls)...
Below are the transactions for Oliver Printing, Incorporated for June, the first month of operations. June 1 Obtain a loan of $ 5 6 , 0 0 0 from the bank by signing a note. June 2 Issue common stock...
Assume an organization must invest $ 7 0 0 , 0 0 0 in fixed costs to produce a product that sells for $ 7 5 and requires $ 4 0 in variable costs to produce one unit. What is the organization s...
hotel delta marriott montreal What do you think is the value and purpose for the hotel brand choosing to make CSR an important part of their overall business strategy? What two recommendations based...
What can you say about the series (an in each of the following cases? (a) (b) (c) an+1 lim an+1 amt, I = 0.8 lim a 11-08 ina an+1 itan
Write out the formula for the total costs of carrying and ordering inventory, and then use the formula to derive the EOQ model. Andria Mullins, financial manager of Webster Electronics, has been...
From 2009 to 2011, the economies of Australia and Switzerland suffered relatively mild effects from the global financial crisis. At the same time, many countries in the euro area were hit hard by...
The zero-lower-bound on short-term interest rates is not a problem, since the central bank can just use quantitative easing to lower intermediate and longer term interest rates instead. Is this...
In a Treasury auction of $2.1 billion par value 91-day T-bills, the following bids were submitted: If only these competitive bids are received, who will receive T-bills, in what quantity, and at what...
You are evaluating a new project for the firm you work for, a publicly listed firm. The firm typically finances new projects using the same mix of financing as in its capital structure, but this...
state, "The subscription price during a rights offering is normally r; lower ; lower r; higher er; higher than the rights-on price and
Arnold inc. is considering a proposal to manufacture high end protein bars used as food supplements by body builders. The project requires an upfront investment into equipment of $1.4 million. This...

Consider the following diagram of a small open economy: a) Calculate net exports and the capital outflow

Question:

Real Interest Rate, r 7% 5% 500 600 Saving Curve Investment Curve 1,000 1,100 Desired Saving and Investment (in billions of dollars)

Step by Step Answer:

Based on the diagramwe can analyze the impact of different world real interest rates on net exports ...View the full answer

Macroeconomics Policy And Practice

Students also viewed these Business questions