(a) How is messenger RNA related to polysome formation? (b) How does rRNA differ from mRNA and...
Question:
(a) How is messenger RNA related to polysome formation?
(b) How does rRNA differ from mRNA and tRNA in specificity?
(c) How does the tRNA molecule differ from that of DNA and mRNA in size and helical arrangement?
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 92% (13 reviews)
a Polysomes are formed when two or more ribosomes are simultaneously translating ...View the full answer
Answered By
Ashington Waweru
I am a lecturer, research writer and also a qualified financial analyst and accountant. I am qualified and articulate in many disciplines including English, Accounting, Finance, Quantitative spreadsheet analysis, Economics, and Statistics. I am an expert with sixteen years of experience in online industry-related work. I have a master's in business administration and a bachelor’s degree in education, accounting, and economics options.
I am a writer and proofreading expert with sixteen years of experience in online writing, proofreading, and text editing. I have vast knowledge and experience in writing techniques and styles such as APA, ASA, MLA, Chicago, Turabian, IEEE, and many others.
I am also an online blogger and research writer with sixteen years of writing and proofreading articles and reports. I have written many scripts and articles for blogs, and I also specialize in search engine
I have sixteen years of experience in Excel data entry, Excel data analysis, R-studio quantitative analysis, SPSS quantitative analysis, research writing, and proofreading articles and reports. I will deliver the highest quality online and offline Excel, R, SPSS, and other spreadsheet solutions within your operational deadlines. I have also compiled many original Excel quantitative and text spreadsheets which solve client’s problems in my research writing career.
I have extensive enterprise resource planning accounting, financial modeling, financial reporting, and company analysis: customer relationship management, enterprise resource planning, financial accounting projects, and corporate finance.
I am articulate in psychology, engineering, nursing, counseling, project management, accounting, finance, quantitative spreadsheet analysis, statistical and economic analysis, among many other industry fields and academic disciplines. I work to solve problems and provide accurate and credible solutions and research reports in all industries in the global economy.
I have taught and conducted masters and Ph.D. thesis research for specialists in Quantitative finance, Financial Accounting, Actuarial science, Macroeconomics, Microeconomics, Risk Management, Managerial Economics, Engineering Economics, Financial economics, Taxation and many other disciplines including water engineering, psychology, e-commerce, mechanical engineering, leadership and many others.
I have developed many courses on online websites like Teachable and Thinkific. I also developed an accounting reporting automation software project for Utafiti sacco located at ILRI Uthiru Kenya when I was working there in year 2001.
I am a mature, self-motivated worker who delivers high-quality, on-time reports which solve client’s problems accurately.
I have written many academic and professional industry research papers and tutored many clients from college to university undergraduate, master's and Ph.D. students, and corporate professionals. I anticipate your hiring me.
I know I will deliver the highest quality work you will find anywhere to award me your project work. Please note that I am looking for a long-term work relationship with you. I look forward to you delivering the best service to you.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Principles of Genetics
ISBN: 978-1119142287
7th edition
Authors: D. Peter Snustad, Michael J. Simmons
Question Posted:
Students also viewed these Life Sciences questions
-
Outline how the genetic message in a gene is translated to produce a polypeptide. Include the roles of the gene, messenger RNA, ribosomes, and transfer RNA.
-
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA
-
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
-
Compute the indicated quantities for the given homomorphism. Ker () for : S 3 Z 2 in Example 13.3 Data from Example 13.3 Let S n be the symmetric group on n letters, and let : S n Z 2 be defined by...
-
Why should you sometimes use normal-curve areas to approximate binomial probabilities even though you have a formula for computing them exactly?
-
A huge 4.0-F capacitor has enough stored energy to heat 2.5 kg of water from 21o C to 95oC. What is the potential difference across the plates?
-
When the task is completed, will it be overspent or underspent?
-
National Orthopedics Co. issued 9% bonds, dated January 1, with a face amount of $500,000 on January 1, 2011. The bonds mature in 2014 (4 years). For bonds of similar risk and maturity the market...
-
Brief Exercise 6-2 X Your answer is incorrect. Try again. Adams Bautista needs $28,500 in 9 years. Click here to view factor tables What amount must he invest today if his investment earns 12%...
-
Tammy Terrified received a notice from the IRS Center demanding payment in full of $50,000 of additional tax, $10,000 in penalties and $5,000 in statutory interest. The computerized statement sets...
-
Identify three different types of RNA that are involved in translation and list the characteristics and functions of each.
-
Outline the process of aminoacyl-tRNA formation.
-
Go to www.nu-solutions.com/downloads/earned_.. value_lite.pdf and access the article by Q. W. Fleming and J. M. Koppelman, Earned Value Lite: Earned Value for the Masses. From your reading, summarize...
-
1.For Zenith Co. the Processing Division sells a computer module to the company's Assembly Division, which assembles the finished product.The Microprocessor Division is currently working at capacity....
-
I. The company "EVERYTHING FRESH EXCEPT THE CHICKEN" buys birds to process and distribute them for human consumption. From the process of these birds 3 products "breasts, thighs and wings" are...
-
What is the decimal value of this 8-bit two's complement number? 1000 0000
-
Direct Disk Drive Company operates a computer disk manufacturing plant. Direct materials are added at the end of the process. The following data were for June2017: Work in process, beginning...
-
You are the director of health information management at an acute care hospital. The hospital's radiology manager has come to you because an employee mistakenly included protected health information...
-
What are the three most common, mandatory deductions withheld from employee paycheques?
-
Multiple Choice Questions: 1. The largest component of aggregate demand is? a. Government purchases. b. Net exports. c. Consumption. d. Investment. 2. A reduction in personal income taxes, other...
-
Suppose that the circulating concentration of hormone is 10 10 M and the Kd for binding to its receptor is 10 8 M. What fraction of the receptors will have hormone bound? If a meaningful...
-
Cells communicate in ways that resemble human communication. Decide which of the following forms of human communication are analogous to autocrine, paracrine, endocrine, and synaptic signaling by...
-
Why do signaling responses that involve changes in proteins already present in the cell occur in milliseconds to seconds, whereas responses that require changes in gene expression require minutes to...
-
Marigold industries had the following inventory transactions occur during 2020: 2/1/20 Purchase 51 units @ $46 cost/unit 3/14/20 purchase 98 units @ $49 cost/unit 5/1/20 purchase 68 units @ $53...
-
In this investment portfolio simulation, you and the bean counters, will invest and manage a fictitional amount of $ 1 , 0 0 0 , 0 0 0 during next three weeks. The simulation includes two fictitional...
-
Roberson Corporation uses a periodic inventory system and the retail inventory method. Accounting records provided the following information for the 2018 fiscal year: Cost Retail Beginning inventory...
Study smarter with the SolutionInn App