b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of nucleotide base DNA sequences: [each line is 60 nucleotide characters in length] Write python code that: i Extract and print the gene id and gene name and organism for a Fasta file called PalGene fasta. (5 marks) ii. Determine and print all 6 reading frame sequences for a DNA sequence in a DNA fasta file with the structure of PalGene fasta (9 marks) iii. Determine and print the amino acid sequence of a DNA fasta, file (assume there is a condon conversion hash table called %codon_conversion) (6 marks) iv. For a given amino acid sequence: display the amino acid and nucleotide start/stop position of its Open Reading Frame (OFR) and the ORF amino acid sequence. (12 marks) Sample Fasta file (only partial DNA sequence is shown) >gi|171361, E. Coli, gamma-lyase(CYS3) gene, 5124bp GCAGCGCACGACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAGGACCTCGCTTGCGAAA. GCTACAGAGCCAACCCGGTGGACAAACTCGAAGTCATTGTGGACCGAATGAGGCTCAATAA b) Given the following Fasta file format (A sample fasta file is shown in Appendix 1) >gene id, gene name, organism, number of nucleotide base DNA sequences: [each line is 60 nucleotide characters in length] Write python code that: i Extract and print the gene id and gene name and organism for a Fasta file called PalGene fasta. (5 marks) ii. Determine and print all 6 reading frame sequences for a DNA sequence in a DNA fasta file with the structure of PalGene fasta (9 marks) iii. Determine and print the amino acid sequence of a DNA fasta, file (assume there is a condon conversion hash table called %codon_conversion) (6 marks) iv. For a given amino acid sequence: display the amino acid and nucleotide start/stop position of its Open Reading Frame (OFR) and the ORF amino acid sequence. (12 marks) Sample Fasta file (only partial DNA sequence is shown) >gi|171361, E. Coli, gamma-lyase(CYS3) gene, 5124bp GCAGCGCACGACAGCTGTGCTATCCCGGCGAGCCCGTGGCAGAGGACCTCGCTTGCGAAA. GCTACAGAGCCAACCCGGTGGACAAACTCGAAGTCATTGTGGACCGAATGAGGCTCAATAA