Consider the problem of searching for genes in DNA sequences. A DNA sequence is represented by a text on the alphabet A, C, G, T, and the gene or gene segment is the pattern. Pattern: TCCTATTCTT Text: TTATAGATCTCGTATTCTTTTATAGATCTCCTATTCTT

a. Construct the good suffix table of the pattern for the Boyer-Moore algorithm.

b. Apply Boyer-Moores algorithm to locate the pattern in the text.

c. Construct the table and a diagram of the FSM used by the KMP algorithm.