Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences.

image
image

Going through the motions... Genotypes to Phenotypes In this activity, you will observe a normal gene and compare it to three (3) mutated sequences. By transcribing and translating each gene sequence, you will determine both where the mutation is located and what type of mutation has occurred. Finally, you will determine how the gene was changed and how it affected the person's phenotype. Procedure: 2) 1) Each student will analyze one of four genes on the back of this sheet: TYR, OCA2, TYRP-1, or SLC45A2. Each student will have a different gene and be responsible for reporting their findings to the other group members. Each form has an original DNA strand and 3 different mutated strands. For each, you will transcribe the mRNA sequence and then translate the mRNA into the amino acid sequence (AAs). 3) With a colored pencil, you will then do the following: First, circle the mutation(s) on each of the three mutated strands that differ from the original DNA strand at the top of your form. (Note: not all sequences start at beginning of gene.) Second, lightly shade over cach codon that differs in the mRNA strand from the original mRNA strand at the top of your form Lastly, lightly shade over each amino acid that differs in the amino acid sequence from the original amino acid sequence at the top of your form 4) Using the amino acid sequences, match one of them to the "Individual" cards at your table to view phenotype. Once your analysis is complete, fill out the table below. Analysis: Making sense of your data Your gene: Original DNA Strand Mutation Mutation 1 Mutation 2 Mutation 3 Mutation Type 16-Albinism: From Genotype to Phenotype How did this change occur? Individual # Gene: TYR (OCA1) Cite your evidence here for mutation type Which of the above mutations caused a change in the phenotype? Which mutation did not result in a change in the phenotype? & Name: Gene affected Name: Original DNA Strand Gene: TYR (OCA1) DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs: Mutation 1 DNA: TACGAGGACCGACAA mRNA: AAs: CATGACGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAGG Mutation 2 DNA: TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTTAAG mRNA: AAs: Mutation 3 DNA: TACGAGAACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGGTAAAG mRNA: AAs:

Step by Step Solution

3.49 Rating (169 Votes )

There are 3 Steps involved in it

Step: 1

Gene TYR OCA1 Mutation 1 Original DNA Strand TACGAGGACCGACAAAACATGACGGACGACACCTCAAAGGTCTGGAGGCGACCGG... blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Managerial Accounting

Authors: Karen W. Braun, Wendy M. Tietz

4th edition

978-0133428469, 013342846X, 133428370, 978-0133428377

More Books

Students also viewed these Accounting questions