5. Huntington disease (HD) is an inherited neurodegenerative disorder, characterized by gradual, irreversible impairment. The genetic mutation underlying HD has been traced to a gene encoding a protein of unknown function. Part of this gene has a repeated sequence of CAG codons (for glutamine). The number of repeats correlates with whether an individual will develop HD. More repeats mean there is a higher probability of disease and earlier onset. A portion of the gene is shown below, beginning with the start codon ATG. The nucleotide sequence of the coding strand of DNA is given on top, with the translated amino acid sequence given below. The CAG repeat region is shaded. Different individuals can have a different number of CAG repeats in their version of this gene. ATGGCGACCCTGGAAAAGCTGATGAAGGCCTTCGAGTCCCTCAAGTCCTTC MATLEKLM KAFESLKS F CAGCAGTTCCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAG QQFQ Q Q Q Q Q Q Q Q Q Q Q Q Q CAGCAGCAGCAGCAGCAGCAGCAACAGCCGCCACCGCCGCCGCCGCCGCCG Q Q Q P P P P P P P P CCGCCTCCTCAGCTTCCTCAGCCGCCGCCG PPP Q L P Q P P P A. (2 points) Write the mRNA sequence that encodes the first four amino acids. Label the 5' and 3' ends. B. (4 points) You decide to design a PCR test to assess the risk of developing HD. Design PCR primers that will amplify the shaded gray region while following these guidelines: a. Do not include any gray region in the primer-binding sites. b. Your PCR product should be as small as possible. c. Each primer should be exactly 20 nucleotides long. Write the sequence of your primers. Label the 5' and 3' ends. C. (2 points) You conduct PCR reactions on your test subjects. a. Propose a technique to analyze the PCR product. b. Explain how the results of the technical analysis will differ for individuals with low vs. high risk of HD.