I am still not fully passing all the tests. The third test is failing not sure what to do.

Now that we have means by which to validate our DNA strands, we can begin comparing them. The core functionality of these comparisons is what we call an "overlap". Recall this example of two strands that overlap: Target: ACGGACATAGTCATT Candidate: CATAGTCATTTCATG Combined: ACGGACATAGTCATTTCATG The idea was to determine if the last part of the target strand overlapped with the first part of a given candidate strand. You can imagine how we might do this