Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Ice-Dreams is a specialty ice cream company making hard-to-find flavors. Its newest two products are Ice-spargus (asparagus flavored) and Ice-amole (guacamole flavored). The main

 

Ice-Dreams is a specialty ice cream company making hard-to-find flavors. Its newest two products are Ice-spargus (asparagus flavored) and Ice-amole (guacamole flavored). The main drivers of production are flavoring and milk. Each product requires different amounts of each ingredient (flavoring and milk), each of which has their own per-unit price. A finite number of units of flavoring and milk are available (30 and 100). Each product is sold for a different price per gallon. These costs and prices are tabulated below. Product Ice-paragus Ice-amole Flavoring (units) Milk (units) Price per gallon ($) 2 5 4 5 Cost per unit $0.25 $0.30 Available units 30 100 $8.50 $9.50 (a) Ice-Dreams wishes to determine how many gallons of each ice cream to produce so as to maximize net profit (sales revenue minus ingredient costs). Assuming all produced ice cream will be sold, formulate this problem as a linear program. (b) Convert the model you created in part (a) into standard form. (c) Use the Simplex Method (both phases if necessary) to either find an optimal solution for this LP or explain why it is impossible to do so.

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Foundations Of Business

Authors: William M. Pride, Robert J. Hughes, Jack R. Kapoor

7th Edition

0357717945, 978-0357717943

More Books

Students also viewed these Mathematics questions

Question

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-

Answered: 1 week ago

Question

The FCC mandates access to the airwaves

Answered: 1 week ago

Question

please show me the process, thanks

Answered: 1 week ago

Question

Explain the business objectives for using social media.

Answered: 1 week ago

Question

Summarize how managers evaluate the financial health of a business.

Answered: 1 week ago