Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on May 11, 2024

If a share expects next year's dividend to be$1.35 and the company's average dividend growth rate is expected to be 6%,then what is the intrinsic

If a share expects next year's dividend to be$1.35 and the company's average dividend growth rate is expected to be 6%,then what is the intrinsic value of the share if the market rate is 9.5%?

Step by Step Solution

★★★★★

3.37 Rating (141 Votes )

There are 3 Steps involved in it

Step: 1

To calculate the intrinsic value of a share using the dividend ... blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Fundamentals of Investments

Authors: Gordon J. Alexander, William F. Sharpe, Jeffery V. Bailey

3rd edition

132926172, 978-0132926171

More Books

Students also viewed these Finance questions

Question

★★★★★

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Answered: 1 week ago

Question

★★★★★

What is the most common measure of the Maintainability Key System Attribute (KSA)?

Answered: 1 week ago

Question

★★★★★

The value of a share of common stock depends on the cash flows it is expected to provide, and those flows consist of the dividends the investor receives each year while holding the stock and the...

Answered: 1 week ago

Question

★★★★★

Ivanhoe Company was formed on July 1, 2018 It was authorized to issue 285,500 shares of $10 par value common stock and 95,400 shares of 8 $25 par value, cumulative and nonparticipating preferred...

Answered: 1 week ago

Question

★★★★★

How does culture affect the role of pay as a motivating force for workers? Would this issue be raised differently in the United States?

Answered: 1 week ago

Question

★★★★★

The responses of a series RLC circuit are vc (t) = 30 - 10e-20t + 30e-10t V iL (t) = 40-20t - 60-10t mA Where vc and iL are the capacitor voltage and inductor current, respectively. Determine the...

Answered: 1 week ago

Question

★★★★★

In a hand of bridge, each of the four players receives 13 cards from a standard pack of 52 cards. Nick and Leopold are partners. What is the probability that, in a given hand, Nick has at most one...

Answered: 1 week ago

Question

★★★★★

The trial balance of the Estate of Tom Beresford at April 17, 200X is as follows Debit (Credit) Principal cash ............$20,750 GM Stock ................$50,000 GMAC Bonds .............$100,000...

Answered: 1 week ago

Question

★★★★★

Secure transmission of HTTP traffic is possible because of SELECT THE CORRECT ANSWER L 2 TP Secure Remote Protocol Transport Layer Security Encryption

Answered: 1 week ago

Question

★★★★★

A rower wants to row her kayak across a channel that is 1400 ft wide and land at a point 800 ft upstream from her starting point. She can row (in still water) at 7 ft/s and the current in the channel...

Answered: 1 week ago

Question

★★★★★

Pls help me out Bruno Corporation is involved in the business of injection molding of plastics. It is considering the purchase of a new computer-aided design and manufacturing machine for $430, 200....

Answered: 1 week ago

Question

★★★★★

Question 14 A company using job-order costing had the following transactions during a calendar year for Job 101: January 1 February 1 March 1 June 1 Date Direct materials purchased Direct materials...

Answered: 1 week ago

Question

★★★★★

Mr. X will retire in 10 years and currently has $200,000 in retirement account. He assumes that he will live up to 20 years after retirement. During those 20 years, he projects annual expenses of...

Answered: 1 week ago

Question

★★★★★

Required information Comprehensive Problem 11-71 (LO 11-1, LO 11-2, LO 11-3, LO 11-4, LO 11-5, LO 11-6) Skip to question [The following information applies to the questions displayed below.] Moab...

Answered: 1 week ago

Question

★★★★★

Serena is a paralegal at a law firm in a small southern town. She studied history in college and completed her paralegal education and certification before moving from a big city to the rural area....

Answered: 1 week ago

Question

★★★★★

Research on laws, programs, best practices of the government, NGOs and communities in response to the challenge of climate change in the Philippines. Make a reflection on how the problems of solid...

Answered: 1 week ago

Question

★★★★★

fix the function count_operations below to get the correct output getting the following results your Output (stdout) 13 33 Expected Output 38 183 def tab(n): tbl = [] i = 0 while i Answered: 1 week ago

Answered: 1 week ago

Question

★★★★★

You continue to work in the corporate office for a nationwide convenience store franchise that operates nearly 10,000 stores. The per- store daily customer count (i.e., the mean number of customers...

Answered: 1 week ago

Question

★★★★★

Predicting elements in aluminum alloys. Aluminum scraps that are recycled into alloys are classified into three categories: softdrink cans, pots and pans, and automobile crank chambers. A study of...

Answered: 1 week ago

Question

★★★★★

MINITAB was used to fit the model y = b0 + b1 x1 + b2 x2 + e to n = 20 data points, and the printout on p. 697 was obtained. a. What are the sample estimates of b0, b1, and b2? b. What is the least...

Answered: 1 week ago

Question

★★★★★

Spall damage in bricks. A recent civil suit revolved around a five-building brick apartment complex located in the Bronx, New York, which began to suffer spalling damage (i.e., a separation of some...

Answered: 1 week ago

Previous Question Next Question