In python

def rna2codon(rna): This function takes in a string representing an RNA sequence, and returns the corresponding amino acid string, as transcribed by this codon table. You do not need to transcribe the stop codon. (HINT: You already did this in Labo3, go open it up and figure out how to incorporate it here!) Example: * Sample RNA string: "AUGGCCAUGGCGCCCAGAACUGAGAUCAAUAGUACCCGUAUUAACGGGUGA" * The returned protein string: "MAMAPRTEINSTRING