Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Jul 17, 2023

It is known that 20% of the adult population in a small community are xYZ supporters. If a random sample of 8 adults are gathered

It is known that 20% of the adult population in a small community are xYZ supporters. If a random sample of 8 adults are gathered in the market place in the community, find the probability that there are at least 5 xYZ supporters.

Step by Step Solution

There are 3 Steps involved in it

Step: 1

Steps Step 1 of 2 Answer From the given data Let X XYZ ... blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Business Statistics For Contemporary Decision Making

Authors: Ken Black, Ignacio Castillo

3rd Canadian Edition

1119577624, 9781119577621

More Books

Students also viewed these Mathematics questions

Question

★★★★★

Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...

Answered: 1 week ago

Question

★★★★★

The accompanying table summarizes data from a medical expenditures survey carried out by the National Center for Health Statistics (Assessing the Effects of Race and Ethnicity on Use of Complementary...

Answered: 1 week ago

Question

★★★★★

Planning is one of the most important management functions in any business. A front office managers first step in planning should involve determine the departments goals. Planning also includes...

Answered: 1 week ago

Question

★★★★★

Once down to about 15, the worlds only wild flock of whooping cranes now numbers a record 237 birds in its Texas Coastal Bend wintering ground (www.SunHerald.com). The average whooping crane egg...

Answered: 1 week ago

Question

★★★★★

What are the major differences between a partnership and a corporation?

Answered: 1 week ago

Question

★★★★★

oyles law Refer to Exercise 32. We took the logarithm (base 10) of the values for both variables. Some computer output from a linear regression analysis on the transformed data is shown below....

Answered: 1 week ago

Question

★★★★★

understand possible effects of ethnicity;

Answered: 1 week ago

Question

★★★★★

Caleb Corporation purchased 2,000 shares of its $10 par value common stock for $120,000 on August 1. It will hold these shares in the treasury until resold. On December 1, the corporation sold 1,200...

Answered: 1 week ago

Question

★★★★★

Gilroy corporation is considering new machine. The machine can be purchased from an overseas supplier for $3,340. The freight and Installation costs for the machine are $620. if purchased, annual...

Answered: 1 week ago

Question

★★★★★

14. A companys policy is to charge depreciation on plant and machinery at 20% per year on cost, with proportional depreciation for items purchased or sold during a year. The companys plant and...

Answered: 1 week ago

Question

★★★★★

content area top Part 1 Find the sample size needed to estimate the percentage of adults who can wiggle their ears. Use a margin of error of 5 percentage points and use a confidence level of 90%....

Answered: 1 week ago

Question

★★★★★

This is a "critical thinking" Partnership project. Perform some Internet research and read about the Diffusion of Innovation (Rogers, 1962) and the 5 types of Human Adopter Groups that must be...

Answered: 1 week ago

Question

★★★★★

Based on the WCDM screen, how can we compare Italy and Japan in terms of overall default risk on their debt? Japan has over 3x the total debt of Italy, and a worse credit rating, so its credit...

Answered: 1 week ago

Question

★★★★★

Briefly explain Feeding America (an organization) Operational Model Based on the various operational models (e.g., entrepreneurial support model, market intermediary model, market linkage model,...

Answered: 1 week ago

Question

★★★★★

Since the proposed medication is injectable are you planning on premediating your patients to avoid any potential injection related reactions?

Answered: 1 week ago

Question

★★★★★

2 . As we move forward with the workshop, we will discuss how important it is to communicate to your audience ( as Florence Nightingale did ) . What does the above graph / chart communicate? What are...

Answered: 1 week ago

Question

★★★★★

by applying ne IRR rule. Year Cash Flow 0 $140,000 48,000 59,000 75,000 1 2 3 bok a. What is the project's IRR? (Do not round intermediate calculations and enter your answer as a percent rounded to 2...

Answered: 1 week ago

Question

★★★★★

Repeat Exercise 16.6 using the t-test of the coefficient of correlation. Is this result identical to the one you produced in Exercise 16.6?

Answered: 1 week ago

Question

★★★★★

Suppose the average speeds of passenger trains travelling from Winnipeg to Churchill in Manitoba are normally distributed, with a mean average speed of 142 km/h and a standard deviation of 10.3 km/h....

Answered: 1 week ago

Question

★★★★★

A marketing analyst carries out a survey to assess whether the amount of money a customer spends in a clothing store depends on how the customer feels about the value he receives, the perceived...

Answered: 1 week ago

Question

★★★★★

According to a study, the proportion of Canadian households relying solely on a cellphone for telephone service is about 13%. A marketing analyst randomly selects 50 Canadian households. a. How many...

Answered: 1 week ago

Question

★★★★★

How does the pricing of medical care in the United States affect the quantity consumed?

Answered: 1 week ago

Question

★★★★★

Explain how monopoly causes an inefficient allocation of resources when the competitive firm does not, even when both seek to maximize profits.

Answered: 1 week ago

Question

★★★★★

What is the difference between average, total, and marginal revenue? What is the shape of the total and marginal revenue curves for the individual competitive firm?

Answered: 1 week ago

Previous Question Next Question