Answered step by step
Verified Expert Solution
Question
1 Approved Answer
Lab Exercise - Practical 8 - part 1 By using a manually generated dot plot, align the provided sequences and calculate their scores accordingly: a
Lab Exercise Practical part By using a manually generated dot plot, align the provided sequences and calculate their scores accordingly: a Sequence A: TCAACTGAGTTCTGTTTAATG Sequence B: TCGACAGGGTTTTGCTTAATG b Sequence C: TCAACTAGTTCTGGTAAGGATTGAG Sequence D: TCGACTACAGTACTGCGTAAGTTGAG Scoring scheme: Match Mismatch Opening gap Gap extension No penalty for terminal gap Include the generated dot plot, manual alignment and scoring calculation in the lab report. Lab Exercise Practical part By utilising the accession ID provided below, answer the following questions accordingly: a On which database the sequences are stored? b Identify the sequence type and provide a brief information regarding each of the sequence c Explore, identify and briefly list out the steps on how to obtain and download the sequence FASTA format for both of the provided IDs d By using the downloaded sequences, conduct PSA using appropriate EMBOSS programs for: i Local alignment ii Global alignment Obtain a snapshot of the obtained results and briefly compare them, plus, include the name of the corresponding programs used to obtain the result of the alignments
Lab Exercise Practical part
By using a manually generated dot plot, align the provided sequences and calculate their scores accordingly:
a Sequence A: TCAACTGAGTTCTGTTTAATG Sequence B: TCGACAGGGTTTTGCTTAATG
b Sequence C: TCAACTAGTTCTGGTAAGGATTGAG
Sequence D: TCGACTACAGTACTGCGTAAGTTGAG
Scoring scheme:
Match
Mismatch
Opening gap
Gap extension
No penalty for terminal gap
Include the generated dot plot, manual alignment and scoring calculation in the lab report.
Lab Exercise Practical part
By utilising the accession ID provided below, answer the following questions accordingly:
a On which database the sequences are stored?
b Identify the sequence type and provide a brief information regarding each of the sequence
c Explore, identify and briefly list out the steps on how to obtain and download the sequence FASTA format for both of the provided IDs
d By using the downloaded sequences, conduct PSA using appropriate EMBOSS programs for:
i Local alignment
ii Global alignment
Obtain a snapshot of the obtained results and briefly compare them, plus, include the name of the corresponding programs used to obtain the result of the alignments
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started