Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Jul 07, 2024

Monopolies, oligopolies, and monopolistic competitive industries all a.earn positive profits in the long run b. raise price and quantity over what would occur in perfect

Monopolies, oligopolies, and monopolistic competitive industries all

a.earn positive profits in the long run

b. raise price and quantity over what would occur in perfect competition in order to maximize their profits.

c.are completely unconstrained in their pricing

d. have market power

Step by Step Solution

There are 3 Steps involved in it

Step: 1

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

OPEC Twenty Years And Beyond

Authors: Ragaei El Mallakh

1st Edition

1317244737, 9781317244738

More Books

Students also viewed these Economics questions

Question

★★★★★

A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-

Answered: 1 week ago

Question

★★★★★

8 Walnut Orchard has two farms that grow wheat and corn. Because of differing soil conditions, there are differences in the yields and costs of growing crops on the two farms. The yields and costs...

Answered: 1 week ago

Question

★★★★★

What role do hormone levels play in mood?

Answered: 1 week ago

Question

★★★★★

The company signed a $1,800,000 contract to build an environmentally friendly access trail to Timpanogas Caves. The project was expected to take approximately three years. The following information...

Answered: 1 week ago

Question

★★★★★

How to make a T-Account for this journal entry? 1-Jan Cash $ 150,000.00 Common Stock $ 20,000.00 Paid in Capital Excess of Par $ 130,000.00 (recording issuance of shares)

Answered: 1 week ago

Question

★★★★★

can you help me solve problems a-d. explain step by step Suppose a survey of adults and teens (ages 12- 17) in a certain country was Number of Texts Adults Teens conducted to determine the number of...

Answered: 1 week ago

Question

★★★★★

Discuss the impact of molecular techniques on modern plant taxonomy. How have methods such as DNA sequencing and molecular phylogenetics revolutionized the classification and understanding of plant...

Answered: 1 week ago

Question

★★★★★

Analyze the role of herbarium specimens in the field of plant taxonomy and their significance for biodiversity studies. How do herbaria contribute to the description and classification of plant...

Answered: 1 week ago

Question

★★★★★

Delve into the technical aspects of remote access controls, specifically RDP and SSH. Discuss the strengths and weaknesses of each protocol in terms of security. Share insights into the most...

Answered: 1 week ago

Question

★★★★★

Briefly answer the following questions: 1. What information is required before data can be encapsulated? 2. What happens when a frame is forwarded to a destination to which it is not intended? How...

Answered: 1 week ago

Question

★★★★★

1. What are the diagnoses of Global Leadership? 2. What solution would you offer based on the definition of Global Leadership?

Answered: 1 week ago

Question

★★★★★

How appropriate is it to conduct additional research?

Answered: 1 week ago

Question

★★★★★

What information remains to be obtained?

Answered: 1 week ago

Question

★★★★★

Within the next three years, is the competition likely to increase, remain unchanged, or decrease?

Answered: 1 week ago

Previous Question Next Question