Answered step by step
Verified Expert Solution
Question
1 Approved Answer
most_common_words.txt: the be and of a in to have it I that for you he with on do say this they at but we his
most_common_words.txt:
the be and of a in to have it I that for you he with on do say this they at but we his from not by she or as what go their can who get if would her all my make about know will up one time there year so think when which them some me people take out into just see him your come could now than like other how then its our two more these want way look first also new because day use no man find here thing give many well only those tell very even back any good woman through us life child work down may after should call world over school still try last ask need too feel three state never become between high really something most another much family own leave put old while mean keep student why let great same big group begin seem country help talk where turn problem every start hand might American show part against place such again few case week company system each right program hear question during play government run small number off always move night live Mr point believe hold today bring happen next without before large million must home under water room write mother area national money story young fact month different lot study book eye job word though business issue side kind four head far black long both little house yes since provide service around friend important father sit away until power hour game often yet line political end among ever stand bad lose however member pay law meet car city almost include continue set later community name five once white least president learn real change team minute best several idea kid body information nothing ago lead social understand whether watch together follow parent stop face anything create public already speak others read level allow add office spend door health person art sure war history party within grow result open morning walk reason low win research girl guy early food moment himself air teacher force offer enough education across although remember foot second boy maybe toward able age policy everything love process music including consider appear actually buy probably human wait serve market die send expect sense build stay fall oh nation plan cut college interest death course someone experience behind reach local kill six remain effect yeah suggest class control raise care perhaps late hard field else pass former sell major sometimes require along development themselves report role better economic effort decide rate strong possible heart drug leader light voice wife whole police mind finally pull return free military price less according decision explain son hope develop view relationship carry town road drive arm true federal break difference thank receive value international building action full model join season society tax director position player agree especially record pick wear paper special space ground form support event official whose matter everyone center couple site project hit base activity star table court produce eat teach oil half situation easy cost industry figure street image itself phone either data cover quite picture clear practice piece land recent describe product doctor wall patient worker news test movie certain north personal simply third technology catch step baby computer type attention draw film Republican tree source red nearly organization choose cause hair century evidence window difficult listen soon culture billion chance brother energy period summer realize hundred available plant likely opportunity term short letter condition choice single rule daughter administration south husband Congress floor campaign material population economy medical hospital church close thousand risk current fire future wrong involve defense anyone increase security bank myself certainly west sport board seek per subject officer private rest behavior deal performance fight throw top quickly past goal bed order author fill represent focus foreign drop blood upon agency push nature color recently store reduce sound note fine near movement page enter share common poor natural race concern series significant similar hot language usually response dead rise animal factor decade article shoot east save seven artist scene stock career despite central eight thus treatment beyond happy exactly protect approach lie size dog fund serious occur media ready sign thought list individual simple quality pressure accept answer resource identify left meeting determine prepare disease whatever success argue cup particularly amount ability staff recognize indicate character growth loss degree wonder attack herself region television box TV training pretty trade election everybody physical lay general feeling standard bill message fail outside arrive analysis benefit sex forward lawyer present section environmental glass skill sister PM professor operation financial crime stage ok compare authority miss design sort act ten knowledge gun station blue strategy clearly discuss indeed truth song example democratic check environment leg dark various rather laugh guess executive prove hang entire rock forget claim remove manager enjoy network legal religious cold final main science green memory card above seat cell establish nice trial expert spring firm Democrat radio visit management avoid imagine tonight huge ball finish yourself theory impact respond statement maintain charge popular traditional onto reveal direction weapon employee cultural contain peace pain apply measure wide shake fly interview manage chair fish particular camera structure politics perform bit weight suddenly discover candidate production treat trip evening affect inside conference unit style adult worry range mention deep edge specific writer trouble necessary throughout challenge fear shoulder institution middle sea dream bar beautiful property instead improve stuff detail method somebody magazine hotel soldier reflect heavy sexual bag heat marriage tough sing surface purpose exist pattern whom skin agent owner machine gas ahead generation commercial address cancer item reality coach Mrs yard beat violence total tend investment discussion finger garden notice collection modern task partner positive civil kitchen consumer shot budget wish painting scientist safe agreement capital mouth nor victim newspaper threat responsibility smile attorney score account interesting audience rich dinner vote western relate travel debate prevent citizen majority none front born admit senior assume wind key professional mission fast alone customer suffer speech successful option participant southern fresh eventually forest video global Senate reform access restaurant judge publish relation release bird opinion credit critical corner concerned recall version stare safety effective neighborhood original troop income directly hurt species immediately track basic strike sky freedom absolutely plane nobody achieve object attitude labor refer concept client powerful perfect nine therefore conduct announce conversation examine touch please attend completely variety sleep involved investigation nuclear researcher press conflict spirit replace British encourage argument camp brain feature afternoon AM weekend dozen possibility insurance department battle beginning date generally African sorry crisis complete fan stick define easily hole element vision status normal Chinese ship solution stone slowly scale university introduce driver attempt park spot lack ice boat drink sun distance wood handle truck mountain survey supposed tradition winter village Soviet refuse sales roll communication screen gain resident hide gold club farm potential European presence independent district shape reader Ms contract crowd Christian express apartment willing strength previous band obviously horse interested target prison ride guard terms demand reporter deliver text tool wild vehicle observe flight facility understanding average emerge advantage quick leadership earn pound basis bright operate guest sample contribute tiny block protection settle feed collect additional highly identity title mostly lesson faith river promote living count unless marry tomorrow technique path ear shop folk principle survive lift border competition jump gather limit fit cry equipment worth associate critic warm aspect insist failure annual French Christmas comment responsible affair procedure regular spread chairman baseball soft ignore egg belief demonstrate anybody murder gift religion review editor engage coffee document speed cross influence anyway threaten commit female youth wave afraid quarter background native broad wonderful deny apparently slightly reaction twice suit perspective growing blow construction intelligence destroy cook connection burn shoe grade context committee hey mistake location clothes Indian quiet dress promise aware neighbor function bone active extend chief combine wine below cool voter learning bus hell dangerous remind moral United category relatively victory academic Internet healthy negative following historical medicine tour depend photo finding grab direct classroom contact justice participate daily fair pair famous exercise knee flower tape hire familiar appropriate supply fully actor birth search tie democracy eastern primary yesterday circle device progress1. Write the function most_common_substring (S,m) that receives a string S and an integer m and returns the substring of length m that appears the most times in S and the number of times that substring appears. Your solution must use a dictionary and run in time O(n). 2. The file most_common_words.txt contains the most common words in the English language, sorted by frequency. Write the function word_rank_dictionary (L) that receives a list L containing the words in the file most_common_words.txt and builds and returns a dictionary D, containing the ranking of each of the words in L. For example, D['the'] should be equal to 1 . 3. Write the function find_anagrams (L) that receives the list of words L as in the previous question and builds and returns a dictionary D where the keys are the sorted characters in a word, and the values are the actual words in L. For example, D['aemt'] should be the list ['team', 'meat', 'mate']. \begin{tabular}{l|l} 46 & m=3 \\ 47 & print ('Anagram sets with \{\} or more members: '. format (m)) \\ 48 & for w in D: \\ 49 & if len (D[w])>=m: \\ 50 & print('key: ', w, ' - anagram list: ', D[w]) \end{tabular} S= ACCAAGGGTTTTGTAGGTGTATACATACCAGGGCAATCGGCAACACGTCTGGTGGAGGTGTGCATAGAACTGCAGTGAGTGTTCGATGTGTGTATTGATAA Sequence length =1 The most common substring is of length 1 is G, it appears 32 times Sequence length =2 The most common substring is of length 2 is GT, it appears 14 times Sequence length =3 The most common substring is of length 3 is GTG, it appears 8 times Sequence length =4 The most common substring is of length 4 is GTGT, it appears 5 times Sequence length =5 The most common substring is of length 5 is AGGTG, it appears 2 times Sequence length =6 The most common substring is of length 6 is AGGTGT, it appears 2 times Sequence length =7 The most common substring is of length 7 is ACCAAGG, it appears 1 times Question 2 The word - them - ranks 55 among the most common words in the English language. The word - the - ranks 1 among the most common words in the English language. The word - data - ranks 512 among the most common words in the English language. The word - structure - ranks 859 among the most common words in the English language. The word - python - is not among the most common words in the English language. The word - a - ranks 5 among the most common words in the English language. The word - algorithm - is not among the most common words in the English language. Question 3 Anagram sets with 3 or more members: key: aemt - anagram list: ['team', 'meat', 'mate'] key: opst - anagram list: [ stop', 'spot', 'post'] key: ader - anagram list: ['read', 'dear', 'dare'] key: opt - anagram list: ['top', 'pot', 'opt'] key: lost - anagram list: ['lots', 'lost', 'slot'] key: deit - anagram list: ['diet', 'tide', 'edit'] key: aelp - anagram list: ['pale', 'leap', 'plea']
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access to Expert-Tailored Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started