Need c++ code

Implement the Dot Plot concept to form Dot plot graph for the following DNA sequences. Also discuss the formation for the Dot plot. Seq1: AGTCAATCGTCAGTCATTTCGATGGTACGTAACGTCGA Seq2: ATGCTAAGTCGATCTAGACTAAGCT OR Replicate the Following DNA Sequence to get Exactly 20 copies of it. The Sample is unstable so you have to stabilize it before Replication. Also it Contains an impurity of PYRIMIDINE DIMMER hence Remove it before replication process. Start replication from the location for first REMOVED DIMMER and CONTINUE it to the location of the last REMOVED DIMMER.