Question:

Genomic sequence of gene of interest:

AACAATCAAACTACTTGTTATTTTTCAAAAACAAACATCACAATCCAACAACCATTTCGTTATTCAACGTACAATTATTAAGTAAATGAAATGAAAAAAGTACGGGAAATGTGAATAGATACTAGCAGACACCGTTGGCTTTCAAATTGGTACATCTCCACTCTATTATATAATGGAGCAAGCTGTCGGCATCTTTAGGTGCTCTGCTTCAATACTTTCTACCTTCCTATGAAGGTAGAGAGACCCTTCTCTTGCATAGTTCAAGTGAGAGTGCCAGAAAATGGGAAGGGCTCCTTGTTGTTCCAAAGTGGGGTTGCACAAAGGTCCATGGACTCCTAAAGAAGATGCATTGCTTACCAAGTATATCCAAGCTCATGGAGAAGGCCAATGGAAATCACTACCCAAAAAAGCAGGTAATTAAGGGTTTAGATGCTAACTTGCCCAATTCATTTCTCAATTTGATATATTGAAATTATCAATAGTTATATAAATGATAATTTATGGTTGAATAACAAAATAAAATCATCCATGTATAACCCATAATACAAAATTTAATATATATTTTAAGAAACACAATTATGCTTGAATTAGATAGAATAAATTCTAATTTATAACTCTGTTTGAATATGCAGGGCTTCTTAGATGTGGAAAAAGTTGTAGATTGAGATGGATGAACTATCTGAGACCAGATATAAAGAGAGGGAACATAACACCAGAAGAAGATGATCTTATAATCAGAATGCATTCACTTTTGGGAAACAGATGGTCCCTCATAGCAGGAAGGTTACCAGGGAGAACAGACAATGAAATAAAGAACTATTGGAACACCCATCTAAGCAAAAAGCTGAAAATTCAAGGAACAGAAGACACAGACACACACAACATGTTAGAGAATCCTCAAGAAGAGCCAGCCAGTGATGGTGGCAACAACAACAAAAAGAAGAAGAAGAACGGTGGCAAAAAGAAGAACAAAGGCAAAGACAATGCTGAGCCACCAAAGACCCAAGTTTACCTACCAAAACCAATTAGAGTGAAGGCTATGTATTTACAGAGAACGGATAGTAACACCTTCACCTTTGATTCCAATTCCAATTCTGCTAGTGGATCAACAAGCCAAGAGAAGGATGAAAGCCCCGTGACAAAAGAATCAAACGTGGTTAGTGAAGTTGGTAATGTGGGAGAAGAAAGTGATGGTTTTGGCTTCTTCAGTGAGGACCATGACTTAGTCAACGCCTCAGATATTGAATGCCAATCTTATTTTCCCACATATCATGGCACCCTACAGCAACTGTATGAAGAATATTTTCAGCTCTTGAACATGGATCAAGGCCAATTCGAACGGAATTCCTTTGCAGAATCTTTATTAGAGTGAAATAATACCAAGAAAAGGCTATTTCAGCTGATAAGAATCAGACTTGTTACTCAAGATGAATTCAAATCTTGTTACCATATGAAAACTTTTTCGGTAGTAAGTCATATGTAAATATCTTTCTAAGCGTTCTATCAGCTTGGAAACTTTTCTTGAACTTAATAAATCTAGTGACCCAATTTAGTTAATCTTTCTTACCTAAAAAATAAATAATTGGAGTGAGAGAATAATATTGAGGATATTCATCAACCGCTTATGTTACTTTATATTTGTATAATTCAGATCCTCTGACCATATCTCA

Dr. Kovinich approaches you after you generate the primers to amplify the GMMYB103 gene (from the previous assignment, Phytozome identifier: Glyma.076054000). Unfortunately for you, he says that this amplified PCR product that codes for the TF needs to be cloned into a plasmid. He provides you the sequence for the PGADT7-AD plasmid that you will be working with. The full plasmid map and sequence for the PGADT7-AD can be found on the course website (and recall that we used this in lecture as well). Dr. Kovinich says that the full-length amplified PCR product for the GMMYB103 gene should be cloned anywhere into the MCs of the PGADT7-AD vector. He suggests that you accomplish this by the following workflow: 1. Engineering a Ndel restriction enzyme recognition site immediately before the start codon and a Xmal recognition site immediately after the stop codon for the gene, using PCR. To accomplish this, Dr. Kovinich says that you will need to redo the PCR described in Assignment 2 with a new set of primers. 2. Cutting both the PCR product and vector with Ndel and Xmal, and appropriately purifying the cut fragments that you wish to work with. You may assume that all restriction enzymes will work at 100% efficiency. 3. Using DNA ligase to join the cut insert and vector together, reforming a circular DNA with the PCR amplicon now incorporated into the vector within the MCS. 4. (8 points) You cut both the plasmid and PCR product with BamHI and purify the fragments you need. You then ligate the cut plasmid with your cut PCR product and complete your cloning experiment. You now need to verify that your new construct is correct. Identify restriction enzymes that you could treat your new construct with to logically confirm that the PCR product containing the GMMYB103 gene was inserted into the vector in the correct orientation. You have full access to gel electrophoresis equipment and the following restriction enzymes. At most, you may only use two restriction enzymes (they are expensive). Assume all listed enzymes work at 100% efficiency. Note that DNA fragments must be at least 100 nucleotides long and differ by at least 100 nucleotides to clearly resolve them by gel electrophoresis. BamHI Bsrl PfIFI Aflll Agel Sacil Indicate the restriction enzymes that you selected and draw the banding pattern you expect on an electrophoretic gel when you complete the verification experiment. You are conducting the verification experiment on three different samples of recombinant plasmid, indicated below. Please use the template provided and indicate exact band sizes. bp MW 1 2 3 10,000 5000 3000 2000 1500 1000 766 Lane MW: NEB Fast DNA Ladder Lane 1: PGADT7 (Digested, No Insert) Lane 2: PGADT7 (Digested, Reversed Insertion) Lane 3: PGADT7 (Digested, Correct Insertion) 500 300 150 50 || Dr. Kovinich approaches you after you generate the primers to amplify the GMMYB103 gene (from the previous assignment, Phytozome identifier: Glyma.076054000). Unfortunately for you, he says that this amplified PCR product that codes for the TF needs to be cloned into a plasmid. He provides you the sequence for the PGADT7-AD plasmid that you will be working with. The full plasmid map and sequence for the PGADT7-AD can be found on the course website (and recall that we used this in lecture as well). Dr. Kovinich says that the full-length amplified PCR product for the GMMYB103 gene should be cloned anywhere into the MCs of the PGADT7-AD vector. He suggests that you accomplish this by the following workflow: 1. Engineering a Ndel restriction enzyme recognition site immediately before the start codon and a Xmal recognition site immediately after the stop codon for the gene, using PCR. To accomplish this, Dr. Kovinich says that you will need to redo the PCR described in Assignment 2 with a new set of primers. 2. Cutting both the PCR product and vector with Ndel and Xmal, and appropriately purifying the cut fragments that you wish to work with. You may assume that all restriction enzymes will work at 100% efficiency. 3. Using DNA ligase to join the cut insert and vector together, reforming a circular DNA with the PCR amplicon now incorporated into the vector within the MCS. 4. (8 points) You cut both the plasmid and PCR product with BamHI and purify the fragments you need. You then ligate the cut plasmid with your cut PCR product and complete your cloning experiment. You now need to verify that your new construct is correct. Identify restriction enzymes that you could treat your new construct with to logically confirm that the PCR product containing the GMMYB103 gene was inserted into the vector in the correct orientation. You have full access to gel electrophoresis equipment and the following restriction enzymes. At most, you may only use two restriction enzymes (they are expensive). Assume all listed enzymes work at 100% efficiency. Note that DNA fragments must be at least 100 nucleotides long and differ by at least 100 nucleotides to clearly resolve them by gel electrophoresis. BamHI Bsrl PfIFI Aflll Agel Sacil Indicate the restriction enzymes that you selected and draw the banding pattern you expect on an electrophoretic gel when you complete the verification experiment. You are conducting the verification experiment on three different samples of recombinant plasmid, indicated below. Please use the template provided and indicate exact band sizes. bp MW 1 2 3 10,000 5000 3000 2000 1500 1000 766 Lane MW: NEB Fast DNA Ladder Lane 1: PGADT7 (Digested, No Insert) Lane 2: PGADT7 (Digested, Reversed Insertion) Lane 3: PGADT7 (Digested, Correct Insertion) 500 300 150 50 ||