Suppose a text that is composed of nucleotides (just A,G,T,C)is given.In a sequence CCCGGGCCC the GGG group is altered.

1)write a program that will ask the user if they want to find the match of the sequence (CCCGGGCCC )in the text or if they want to find the possible altered sequences that can be CCCxxx(any nucleotide A,G,T,C in place of x )CCC.

2)Then write the functons to find the exact match and all the altered match.

one possible text file :CCCGCGCCCCCCGGGCCCATGTGTGAGCCCCAAACCCGGGCCGCCCCGAGCCCCCCACACCCCTAGTGTCCCGAGCC

please explain the steps

There will be 3 different functions.

Use python 3