Question: table [ [ 1 5 . , , , ] , [ table [ [ A ) ] ] , table [

\table[[15.,,,],[\table[[A)]],\table[[Manipulating the database by],[retrieving, modification and accessing],[data through the web]],B.,Transforming data format.],[C.,Sharing by a set of concurrent users.,D.,Presentation and visualization of data]]
\ table [ [ 1 5 . , , , ] , [ \ table [ [ A ) ] ]

Step by Step Solution

There are 3 Steps involved in it

1 Expert Approved Answer
Step: 1 Unlock blur-text-image
Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock
Step: 3 Unlock

Students Have Also Explored These Related Programming Questions!

Q:

APPLICATION PROBLEM SET 3 Problem 3.1 Creating an Access Database Using an Excel File Each worksheet in the Company.xls file represents a different table in a simple company database. You are to use...

Q:

(c) Server-side i. Create a database table Modify table-manager.php to create a new table in your database. (3 marks) So far the code has used an existing database table called tt284_guests, but that...

Q:

PHP web question answer needed in coding please Ia. Configure to use the new table Modify tma02_admin.php to use the new table. Only a single line of code should be changed. In your solution...

Q:

PHP web question Ia. Configure to use the new table Modify tma02_admin.php to use the new table. Only a single line of code should be changed. In your solution document, provide your code. You should...

Q:

Ia. Configure to use the new table Modify tma02_admin.php to use the new table. Only a single line of code should be changed. In your solution document, provide your code. You should perform some...

Q:

As soon as you have opened a new database file in Access in order to create this assignment, you must save and name this file: "TA4_Lastname_Firstname" where Lastname is your last name and Firstname...

Q:

For all parts of this project, your system must be application or web-based. Some simple GUI interfaces are required for each functionality. All functionality must be performed via the interface of...

Q:

The code to be modified: Executing: Saving data from $data array to row in database table $sql ==

Q:

This is the code to be modified: Executing: Saving data from $data array to row in database table $sql ==

Q:

THIS QUESTION IS ABOUT .PHP PLEASE DO NOT ANSWER IN HTML! Store booking reference in the database Modify tma02_save-row.php to add the data from the booking reference field to the database. (10...

Q:

Keynesians believe that there is an indirect effect between the money market and the product market. 1. State the Keynesian transmission mechanism. 2. Graphically show the effect of an increase in...

Q:

Initial DNA sequence 3 GCCATTACTGAGGATCGGAAGCTCTTGCA5' 1. To understand what happens under normal conditions, transcribe this DNA strand into its mRNA mRNA= Using this newly made mRNA, translate it...

Q:

A cost that cannot be readily identified to a final cost objective is referred to as:

Q:

Determine the domain and range. Is the relation a function? 2 Domain: (-3, 3} Choose... + Domain: -3