Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Jan 28, 2020

The leader sequence of the meta transcript involved in methionine biosynthesis in Bacillus subtilis acts as a riboswitch that binds S-adenosylmethionine (SAM) in a manner

The leader sequence of the meta transcript involved in methionine biosynthesis in Bacillus subtilis acts as a riboswitch that binds S-adenosylmethionine (SAM) in a manner analogous to the youtH leader RNA. What phenotype would be expected of cells with a mutation in metI in which the leader was unable to bind with SAM?

Step by Step Solution

★★★★★

3.38 Rating (151 Votes )

There are 3 Steps involved in it

Step: 1

Explanation A riboswitch is the mRNA that binds to another molec... blur-text-image

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Organic Chemistry

Organic Chemistry

Authors: Paula Yurkanis Bruice

4th edition

131407481, 978-0131407480

More Books

Students also viewed these Biology questions

Question

★★★★★

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? AGAGUCCGAGACUUGACGUGA

Answered: 1 week ago

Question

★★★★★

McCullough Hospital uses a job-order costing system to assign costs to its patients. Its direct materials include a variety of items such as pharmaceutical drugs, heart valves, artificial hips, and...

Answered: 1 week ago

Question

★★★★★

A youth soccer club has contracted with Holiday Helpers, a local travel agency, to broker hotel rooms for out-of-town teams that have entered the club's Labor Day weekend soccer tournament. The...

Answered: 1 week ago

Question

★★★★★

The average of 4 consecutive odd positive integers is 16. The product of the smallest and largest positive odd integer is 1. 210 2. 247 3. 294 4. 320 None of the above 5.

Answered: 1 week ago

Question

★★★★★

The following cross tabulation summarizes the data for two categorical variables, x and y. The variable x can take on values low, medium, or high and the variable y can take on values yes or no. a....

Answered: 1 week ago

Question

★★★★★

Should someone who is not majoring in marketing take a course in personal selling? In sales management?

Answered: 1 week ago

Question

★★★★★

=+16The Consumer Price Index (CPI) represents changes in prices of all goods and services purchased for consumption by urban households. User fees (such as water and sewer service) and sales and...

Answered: 1 week ago

Question

★★★★★

One company purchases the outstanding debt instruments of an affiliated company on the open market. This transaction creates a gain that is appropriately recognized in the consolidated financial...

Answered: 1 week ago

Question

★★★★★

Please solution assignmnet 1 and 2 it is c++ subject Student Name: Assignment #1: Write a program that calculate and print the result of the following series. Assignment #2: Write a program that...

Answered: 1 week ago

Question

★★★★★

1. a) Why do you disagree with Jack's comments about the uselessness of the regression due to the low R-squared? (b) Can you think of a situation in which a useless regression has a high R-squared?...

Answered: 1 week ago

Question

★★★★★

An avant-garde clothing manufacturer runs a series of high-profile, risque ads on a billboard on Highway 101 and regularly collects protest calls from people who are offended by them. The company has...

Answered: 1 week ago

Question

★★★★★

A particle of mass \( m \) moves under the influence of a conservative force described by the potential energy function \( U(x) = \frac{kx^2}{2} \), where \( k \) is a constant and \( x \) is the...

Answered: 1 week ago

Question

★★★★★

A 2 kg block slides on a horizontal frictionless surface with a velocity of 4 m/s. It collides elastically with a stationary block of mass 3 kg. Determine the final velocities of both blocks after...

Answered: 1 week ago

Question

★★★★★

A satellite of mass 500 kg is orbiting Earth at an altitude where the gravitational acceleration is \( 7.5 \, \text{m/s}^2 \). Calculate the gravitational force acting on the satellite and the...

Answered: 1 week ago

Question

★★★★★

Question 1 Calculate the limit: \[ \lim_{{x \to 0}} \frac{\sin(5x)}{x} \] Question 2: Find the derivative of the function \( f(x) = x^3 - 3x^2 + 4x - 7 \).

Answered: 1 week ago

Question

★★★★★

Question 1: Evaluate the integral: \[ \int (2x^2 - 3x + 5) \, dx \] Question 2: Determine the convergence or divergence of the improper integral: \[ \int_1^\infty \frac{1}{x^2} \, dx \] Question 3:...

Answered: 1 week ago

Question

★★★★★

Windsor Company leases an automobile with a fair value of $14,845 from John Simon Motors, Inc., on the following terms: 1. Non-cancelable term of 50 months. 2. Rental of $310 per month (at the...

Answered: 1 week ago

Question

★★★★★

What is the shape of the exponential distribution?

Answered: 1 week ago

Question

★★★★★

Which of the following two compounds would eliminate HBr more rapidly in basic solutions? CH2Br or CH2Br

Answered: 1 week ago

Question

★★★★★

a. Is (R)-lactic acid dextrorotatory or levorotatory? b. Is (R)-sodium lactate dextrorotatory or levorotatory?

Answered: 1 week ago

Question

★★★★★

A solution of 4-methyl-3-penten-2-one in ethanol shows an absorbance of 0.52 at 236 nm in a cell with a 1-cm light path. Its molar absorptivity in ethanol at that wavelength is 12,600. What is the...

Answered: 1 week ago

Question

★★★★★

As scientists, psychologists keep their methods private so others will not repeat their research. assume the truth of articles published in leading scientific journals. reject evidence that competes...

Answered: 1 week ago

Question

★★★★★

A study finds that the more childbirth training classes women attend, the less pain medication they require during childbirth. This finding can be stated as a _______ (positive/negative) correlation.

Answered: 1 week ago

Question

★★★★★

To test the effect of a new drug on depression, researchers randomly assign people to control and experimental groups. People in the control group take a pill that contains no medication. This pill...

Answered: 1 week ago

Previous Question Next Question