Answered step by step

Verified Expert Solution

Link Copied!

Question

1 Approved Answer

Posted on Sep 06, 2024

UNIX Search for the sequence 'TTATCCGGATTTATTGGGTTTAAAGGGT' in the F3D0_S188_L001_R1_001.fastq file and in the output have the sequence name and the sequence. Example @M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG

UNIX

Search for the sequence 'TTATCCGGATTTATTGGGTTTAAAGGGT' in the F3D0_S188_L001_R1_001.fastq file and in the output have the sequence name and the sequence.

Example

@M00967:43:000000000-A3JHG:1:2114:11799:28499 1:N:0:188 TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCAG

Step by Step Solution

There are 3 Steps involved in it

Step: 1

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

Step: 3

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Students also viewed these Databases questions

Question

5. Do you have a dark seducer or seductress figure in your script? How can you evoke the primal forces of the incubus or succubus within these figures, to make them seem more powerful and...

Answered: 1 week ago

Question

★★★★★

The comparative balance sheets of Orpheum Movie Theater Company at June 30, 2014, and 2013, reported the following: Orpheum Movie Theaters transactions during the year ended June 30, 2014, included:...

Answered: 1 week ago

Question

★★★★★

Transactions where a buyer accepts title and billings but delays receipt of the goods is a bill-and-hold arrangement. O True O False Click to select your

Answered: 1 week ago

Question

★★★★★

All EXCEPT which one of the following are specific concerns that need to be addressed to ensure responsible activities to protect the health and aesthetics of near-shore marine environments and coral...

Answered: 1 week ago

Question

★★★★★

INDIVIDUAL TAX RETURN PROBLEM 2Required: Use the following information to complete Johnelle and Latoya Henry's 2016federal income tax return. If information is missing, use reasonable assumptions to...

Answered: 1 week ago

Question

★★★★★

Veach Division has total assets ( net of accumulated depreciation ) of $ 4 6 2 , 0 0 0 at the beginning of year 1 . One of the assets is a machine that has a net book value of $ 4 8 , 7 2 0 ....

Answered: 1 week ago

Question

★★★★★

You need to implement the following for the users in the marketing department: Open a customer relationship management (CRM) popup when the users receive a Teams call. Ensure that SIP devices can be...

Answered: 1 week ago

Question

★★★★★

Southern Amusements Corporation had the following stockholders' equity on November 30: On December 30, Southern purchased 200 shares of treasury stock at $15 per share. Southern Amusements...

Answered: 1 week ago

Question

★★★★★

What is meant by "satisfying the customer" as a manager in a healthcare industry

Answered: 1 week ago

Previous Question Next Question