What do you set the Product Group and Polymerase to in the NEB Tm Calculator and why? Given the following DNA sequence design primers with a Tm of 55 which contain a BgIII site AGATCT before the Start sequence and after the Stop sequence (in bold). Be sure make before the Start codon and after the Stop codon. Be sure to highlight the original unaltered sequence in the DNA. Sequence name # 53 TGAGAAGACTGAGCGGGTGATCATCGGATTTGAAAATGAGATCGACACCACGATTTT- GAAA// IICGATTCTATCAAAAACGATTAATCCTGAATTAGGATAAGTAGGAAAGCCCTG GAGAC- GTGTATCGTCTTCAGGGCTTT 3. Write out both Primers for the 5' end (Forward Primer) and 3' end (Reverse Primer) using the naming protocol described in the instructions 5' Primer 3' Primer. 4. What does the Tm represent and why must primers be within +/- 2 degrees of one another? 51