Answered step by step
Verified Expert Solution
Question
00
1 Approved Answer
Write a bash script that removes all white spaces or newline characters(like in the below example), and count the exact number of bases present. It's
Write a bash script that removes all white spaces or newline characters(like in the below example), and count the exact number of bases present. It's a large sequence and similar new line characters/ white spaces appear in other parts of the sequence, but the goal is to be able to count all the sequences without counting the white spaces as that inflates the count. Please write using bash script.
CTATGATAGGACATCTCTTGGAGACACCTATTAATGTTTCAGAAACGGATACCTTGGTTG TCCAGTACGAAATTAAGTTGGACAATTCTTTGACGTGCGGC CTATATTAAAATTGTGGGTACATCACTCTCTTACCTGAGAATTCCAACAGAGCAGGACGC
Step by Step Solution
There are 3 Steps involved in it
Step: 1
Get Instant Access with AI-Powered Solutions
See step-by-step solutions with expert insights and AI powered tools for academic success
Step: 2
Step: 3
Ace Your Homework with AI
Get the answers you need in no time with our AI-driven, step-by-step assistance
Get Started