You have the following gene sequence, you want to amplify. Design primers for this sequenceamplification. (Also note that this is a single strand of DNA you have to write the other strand too).The primer length should be 15bp. Indicate the 5’ and 3’ ends of the primer.5' GGATCGATCAAGAACAATGACAGGATCGAGGAATTCAGCCTACGCAGCCCGTAGCTGGAGGGA 3'a) What other reagents will be required in this PCR reaction.b) What is the purpose of each stage in the PCR cycle, and roughly what temperatures areused?c) After