1. If you were a consultant for Filmhouse, how would you advise Kene Mpkaru regarding his...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
1. If you were a consultant for Filmhouse, how would you advise Kene Mpkaru regarding his next moves in Nigeria? 2. What specific aspects of the country are positive for the company? What factors are negatives? 3. How would you deal with the wealth gap in the country? 4. Would you advise Filmhouse to concentrate on Nollywood productions, or would you try to attract Hollywood movies? Nigeria In the Imternational Spotlight Located in western Africa. Nigeria is situated between the ash-Sham (ISIS)-West Africa, reside in the northeast of countries of Benin and Cameroon on the Gulf of Guinea. Nigeria. Both aim to replace the Nigerian government with an The Niger River, perhaps the most important river in west- ern Africa, flows into the country through Niger and emp- gional military targets in order to expand their foothold on the ties into the Gulf of Guinea. The total land mass of Nigeria region. Boko Haram has killed tens of thousands of Nigerians is slightly larger than twice the size of California. Its natural resources include natural gas, petroleum, tin, iron ore, coal, activity associated with Western society. Additionally, the limestone, niobium, lead, zinc, and arable land. The climate country still struggles with infant and maternal mortality and is tropical in most of the country, although the northern has the highest number of deaths due to AlDS globally." portion of the country is quite arid." The British empire controlled a majority of Africa and, You Be the International Management Consultant specifically, Nigeria from the early 19th century until the end of World War II. Nigeria gained its independence in 1960, but its politics consisted of military regimes and numerous coups. company's presence in the country. Although the movie in- Military rule continued until the adoption of a new constitu- dustry in Nigeria currently consists of viewers watching mov- tion in 1999, which transitioned the country's government into a civilian one. Since this transition, the political environ- ment has been relatively stable, consisting of legitimate and regular elections. The country is, however, still feeling the ef- fects of the four decades of corruption and mismanagement. With over 203.4 million people and a growth rate of 2.5 percent in 2019, Nigeria is Africa's most populous nation and one of the fastest growing. Population projections indi- cate that the nation will grow to nearly 400 million by 2050, becoming the world's fourth most populous country. The official spoken language is English, due to Nigeria's history as a part of the British empire. The country is incredibly Option was a high-end theater that included a full dining expe- diverse, with more than 250 ethnic groups. Religiously, Nigeria is split evenly between Muslims and Christians. This spiritual division has led to significant unrest and civil wars from the time of its independence until recent history. The country's population is younger than most. Nigeria faces the difficult challenge of harnessing the potential of its young population (median age of 18.3 years in 2018) to boost eco- nomic development, reduce widespread poverty, and channel individuals into productive activities instead of ongoing reli- Đous and ethnic violence. Wealth inequality is especially pro hounced in Nigeria, leaving a large gap between the "haves" and have nots." With a GDP per capita in 2018 of US$2.100, over 0 percent of the country's population lives below the poverty he. Nigeria's total 2018 GDP stood at US$409 billion and has been experiencing a slowing, but still steady, economic growth. In 2018, the economy expanded by just over 2 percent. Nigeria still faces major challenges. Two large terrorist ecups, Boko Haram and the Islamic State of Iraq and Islamic state under Sharia law and attack both civilian and re over the last decade, violently targeting any political or social 59.60 The Nigerian owner of the Filmhouse Cinemas franchise, Kene Mpkaru, has announced a significant expansion of his ies in their homes, Mpkaru believes there is growth potential for in-theater watching Mpkaru has some expertise in the movie theater business; prior to owning his Nigerian fran- chise, he worked for a European franchise and oversaw sub- stantial expansion. Currently, Filmhouse has 9 movie theaters in Nigeria, and the company plans to open 16 additional loca- tions. The greatest challenge to doing business in the country is the relatively low purchasing power of the consumers, with more than 60 percent of the population living below the pov- erty line. Prior to Filmhouse, Nigeria's main movie theater rience, costing approximately USS40 per ticket." Nigeria has built a film industry of its own in recent years. The country's movies, generally shot with very small budgets, are often released directly to DVD. This industry, referred to as "Nollywood." accounts for approximately 1.5 percent of the nation's GDP, or US$7 billion. For Filmhouse, this domestic industry could serve as an attractive expansion vehicle." 56 Questions 1. If you were a consultant for Filmhouse, how would you advise Kene Mpkaru regarding his next moves in Nigeria? 2. What specific aspects of the country are positive for the company? What factors are negatives? 3. How would you deal with the wealth gap in the country? 4. Would you advise Filmhouse to concentrate on Nollywood productions, or would you try to attract Hollywood movies? wond map beckgiound with 1. If you were a consultant for Filmhouse, how would you advise Kene Mpkaru regarding his next moves in Nigeria? 2. What specific aspects of the country are positive for the company? What factors are negatives? 3. How would you deal with the wealth gap in the country? 4. Would you advise Filmhouse to concentrate on Nollywood productions, or would you try to attract Hollywood movies? Nigeria In the Imternational Spotlight Located in western Africa. Nigeria is situated between the ash-Sham (ISIS)-West Africa, reside in the northeast of countries of Benin and Cameroon on the Gulf of Guinea. Nigeria. Both aim to replace the Nigerian government with an The Niger River, perhaps the most important river in west- ern Africa, flows into the country through Niger and emp- gional military targets in order to expand their foothold on the ties into the Gulf of Guinea. The total land mass of Nigeria region. Boko Haram has killed tens of thousands of Nigerians is slightly larger than twice the size of California. Its natural resources include natural gas, petroleum, tin, iron ore, coal, activity associated with Western society. Additionally, the limestone, niobium, lead, zinc, and arable land. The climate country still struggles with infant and maternal mortality and is tropical in most of the country, although the northern has the highest number of deaths due to AlDS globally." portion of the country is quite arid." The British empire controlled a majority of Africa and, You Be the International Management Consultant specifically, Nigeria from the early 19th century until the end of World War II. Nigeria gained its independence in 1960, but its politics consisted of military regimes and numerous coups. company's presence in the country. Although the movie in- Military rule continued until the adoption of a new constitu- dustry in Nigeria currently consists of viewers watching mov- tion in 1999, which transitioned the country's government into a civilian one. Since this transition, the political environ- ment has been relatively stable, consisting of legitimate and regular elections. The country is, however, still feeling the ef- fects of the four decades of corruption and mismanagement. With over 203.4 million people and a growth rate of 2.5 percent in 2019, Nigeria is Africa's most populous nation and one of the fastest growing. Population projections indi- cate that the nation will grow to nearly 400 million by 2050, becoming the world's fourth most populous country. The official spoken language is English, due to Nigeria's history as a part of the British empire. The country is incredibly Option was a high-end theater that included a full dining expe- diverse, with more than 250 ethnic groups. Religiously, Nigeria is split evenly between Muslims and Christians. This spiritual division has led to significant unrest and civil wars from the time of its independence until recent history. The country's population is younger than most. Nigeria faces the difficult challenge of harnessing the potential of its young population (median age of 18.3 years in 2018) to boost eco- nomic development, reduce widespread poverty, and channel individuals into productive activities instead of ongoing reli- Đous and ethnic violence. Wealth inequality is especially pro hounced in Nigeria, leaving a large gap between the "haves" and have nots." With a GDP per capita in 2018 of US$2.100, over 0 percent of the country's population lives below the poverty he. Nigeria's total 2018 GDP stood at US$409 billion and has been experiencing a slowing, but still steady, economic growth. In 2018, the economy expanded by just over 2 percent. Nigeria still faces major challenges. Two large terrorist ecups, Boko Haram and the Islamic State of Iraq and Islamic state under Sharia law and attack both civilian and re over the last decade, violently targeting any political or social 59.60 The Nigerian owner of the Filmhouse Cinemas franchise, Kene Mpkaru, has announced a significant expansion of his ies in their homes, Mpkaru believes there is growth potential for in-theater watching Mpkaru has some expertise in the movie theater business; prior to owning his Nigerian fran- chise, he worked for a European franchise and oversaw sub- stantial expansion. Currently, Filmhouse has 9 movie theaters in Nigeria, and the company plans to open 16 additional loca- tions. The greatest challenge to doing business in the country is the relatively low purchasing power of the consumers, with more than 60 percent of the population living below the pov- erty line. Prior to Filmhouse, Nigeria's main movie theater rience, costing approximately USS40 per ticket." Nigeria has built a film industry of its own in recent years. The country's movies, generally shot with very small budgets, are often released directly to DVD. This industry, referred to as "Nollywood." accounts for approximately 1.5 percent of the nation's GDP, or US$7 billion. For Filmhouse, this domestic industry could serve as an attractive expansion vehicle." 56 Questions 1. If you were a consultant for Filmhouse, how would you advise Kene Mpkaru regarding his next moves in Nigeria? 2. What specific aspects of the country are positive for the company? What factors are negatives? 3. How would you deal with the wealth gap in the country? 4. Would you advise Filmhouse to concentrate on Nollywood productions, or would you try to attract Hollywood movies? wond map beckgiound with
Expert Answer:
Answer rating: 100% (QA)
1 There is a huge potential for growth of the company if the company can expand the movie theatres f... View the full answer
Related Book For
Posted Date:
Students also viewed these general management questions
-
What is dollar-cost averaging? If you were a particularly astute investor at timing moves in the market, would you want to use dollar-cost averaging?
-
If you were a media planner, which Canadian media vehicles would you choose to reach the baby boomers? Would you use traditional and/or digital media vehicles? Which specific tools would you select?...
-
How could you use the Internet if you were a traveling salesperson?
-
M/s Active Builders Ltd. invested in the shares of another company (with an intention to hold the shares for short term period )on 31st October, 2016 at a cost of Rs.4,50,000. It also earlier...
-
Consulting Table 24.3, write the amino-acid sequence resulting from left-to-right translation of the messenger RNA sequence GGAUCCCGCUUUGGGCUGAAAUAG
-
During the early stages of Earths development, when the entire planet was molten, there were no rocks. What kind of rocks must have been the first to form? (a) igneous rocks (b) sedimentary rocks (c)...
-
To compare power consumption by a newly developed low-power USB device under three test run conditions and record the data transmission rate at the same time, a computer engineer obtained the...
-
The unadjusted and adjusted trial balances for Editorial Services Co. on March 31, 2014, are shown below. Journalize the five entries that adjusted the accounts at March 31, 2014. None of the...
-
A property owner is evaluating the following alternatives for leasing space in his office building for the next five years: Net lease with steps. Rent will be $15 per square foot the first year and...
-
Adam and Eve are partners in a wedding catering business. Adam is responsible for the cake design and baking, while Eve handles the cake orders, supplies and accounting. The following are true...
-
Attorney Liberty's client, Marcella, a portrait painter, is being sued by one of her clients, Dillon. Marcella does not believe that Dillon has a valid lawsuit against her and has consulted Liberty...
-
There are numerous pros and cons to using newspaper advertising. Define and explain each.
-
What are the implications of failing to consider the ecological model when shaping interventions health communicators consider and choose?
-
Describe the key constituents of the logic model. Give two examples for each.
-
How is marketing public relations different from traditional public relations?
-
How do cultural differences play a role in an individuals health literacy?
-
Alfred E. Old and Beulah A. Crane, each age 42, married on September 7, 2020. Alfred and Beulah will file a joint return for 2022. Alfred's Social Security number is 111-11-1109. Beulah's Social...
-
The executor of Gina Purcells estate has recorded the following information: Assets discovered at death (at fair value): Cash . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . ....
-
What types of situations might cause the U.S. government to implement protectionist measures?
-
How do the three levels of management differ?
-
Assume you are the manager of human resources at a manufacturing company that employs about 500 people. A recent cyclical downturn in your industry has led to financial losses, and top management is...
-
Consider the situation illustrated in Figure 25. 11. A positively charged particle is lifted against the uniform electric field of a negatively charged plate. Ignoring any gravitational interactions,...
-
A positively charged particle is moved from point A to point B in the electric field of the massive, stationary, positively charged object in Figure 25. 12. (a) Is the electrostatic work done on the...
-
Figure 25. 13 shows both the electric field lines and the equipotentials associated with the given charge distribution. (a) Is the potential at point A higher than, lower than, or the same as the...
Study smarter with the SolutionInn App