A homologous DNA region, which was 20,000 bp in length, was sequenced among four different species. The
Question:
Construct a phylogenetic tree that describes the evolutionary relationships among these four species using the UPGMA method. Your tree should include values that show the percentage of nucleotide substitutions.
Transcribed Image Text:
Species A Species B Species CSpecies D Species A Species B Species C Species D 465 423 723 443 719 443 719 465 744 744 423 723
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 77% (9 reviews)
We begin by identifying the pair that is the most closely related In this case it is species B and D ...View the full answer
Answered By
JAPHETH KOGEI
Hi there. I'm here to assist you to score the highest marks on your assignments and homework. My areas of specialisation are:
Auditing, Financial Accounting, Macroeconomics, Monetary-economics, Business-administration, Advanced-accounting, Corporate Finance, Professional-accounting-ethics, Corporate governance, Financial-risk-analysis, Financial-budgeting, Corporate-social-responsibility, Statistics, Business management, logic, Critical thinking,
So, I look forward to helping you solve your academic problem.
I enjoy teaching and tutoring university and high school students. During my free time, I also read books on motivation, leadership, comedy, emotional intelligence, critical thinking, nature, human nature, innovation, persuasion, performance, negotiations, goals, power, time management, wealth, debates, sales, and finance. Additionally, I am a panellist on an FM radio program on Sunday mornings where we discuss current affairs.
I travel three times a year either to the USA, Europe and around Africa.
As a university student in the USA, I enjoyed interacting with people from different cultures and ethnic groups. Together with friends, we travelled widely in the USA and in Europe (UK, France, Denmark, Germany, Turkey, etc).
So, I look forward to tutoring you. I believe that it will be exciting to meet them.
3.00+
2+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Biology questions
-
Lets assume the linker DNA averages 54 bp in length. How many molecules of H2A would you expect to find in a DNA sample that is 46,000 bp in length?
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
A team of researchers has obtained a dinosaur bone (Tyrannosaurus rex) and has attempted to extract ancient DNA from it. Using primers to the 12S rRNA mitochondrial gene, they have used PCR and...
-
1. [20 points] A mattress manufacturer has three production facilities located in Pittsburg (PA), Houston (TX), and Los Angeles (CA). They supply their products to three distribution centers in...
-
The town of Whoville has 100 identical consumers and 50 identical car washes. Each consumer has an income of $24. The diagram and chart below show the indifference curves of a typical consumer and...
-
What are the pros and cons of computer-assisted communication technology and computer-assisted decision-aiding technology? What view do you take of such technology: utopian, dystopian, neutral, or...
-
(f) Obtain diagnostic plots of the residuals from your analysis.
-
Hatch Manufacturing produces multiple machine parts. The theoretical cycle time for one of its products is 65 minutes per unit. The budgeted conversion costs for the manufacturing cell dedicated to...
-
BKAR2023 FINANCIAL ACCOUNTING AND REPORTING II Please answer Not in handwriting as soon as possible, (thanks in advance) TopElectronic Bhd is a manufacturer and supplier of electronic and computer...
-
After reading the companion article ( Viewing Brands in Multiple Dimensions ) and reviewing the companion video (What Consumers Want), provide an executive briefing note regarding the significance to...
-
Discuss how the principle of parsimony can be used in a cladistics approach of constructing a phylogenetic tree.
-
As discussed in this chapter and Chapter 26, genes are sometimes transferred between different species via horizontal gene transfer. Discuss how horizontal gene transfer might give misleading results...
-
Refer to the Real World Application in this chapter. What was the effect of maintaining minimal inventories for the Apache helicopter during the Persian Gulf War?
-
1 . Journalize the following transactions: ( a ) Issued 1 , 0 0 0 shares of $ 1 0 par common stock at $ 5 9 for cash. ( b ) Issued 1 , 4 0 0 shares of $ 1 0 par common stock in exchange for equipment...
-
Using alpha .05, determine if moving to a larger enclosure decreased tiger anxiety levels. You should first calculate the difference (After - Before) Tiger Before Anthony 45 45 Banthony 56 After 38...
-
Cyclohexane (C 6 H 12 ) is produced by mixing Benzene and hydrogen. A process including a reactor, separator, and recycle stream is used to produce Cyclohexane. The fresh feed contains 260L/min C 6 H...
-
Suppose the city is undergoing severe ination. Specifically, both goods prices have risen by 10%. What percentage of a raise in the wage rate should Alex request from her boss, for her to maintain...
-
1. An iron cube of mass 0.55 kg is raised to a temperature of 100C by being placed in boiling water for 5 minutes. It is then removed and transferred immediately to an aluminium calorimeter filled...
-
Why do you think restaurants have different reservation policies, and why might each restaurant be using an efficient allocation method?
-
"Standard-cost procedures are particularly applicable to process-costing situations." Do you agree? Why?
-
Is it possible for spruce trees to grow directly on the rocks deposited by glaciers? Why or why not?
-
Why do you think that weeds can initially establish sites undergoing secondary succession, rather than the lichens that must initially colonize environments undergoing primary succession?
-
Distinguish between freshwater wetlands and estuaries and between flowing-water and standing-water ecosystems.
-
Estimate the intrinsic value of the stock company ABC. Dividends were just paid at $8 per share and are expected to grow by 5%. You require 20% on this stock given its volatile characteristics. If...
-
Crane, Inc., a resort management company, is refurbishing one of its hotels at a cost of $6,794,207. Management expects that this will lead to additional cash flows of $1,560,000 for the next six...
-
Match each of the following transactions with the applicable internal control principle that is being violated
Study smarter with the SolutionInn App