Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was
Question:
Draw the complete structure of the deoxyribonuclcotide sequence from which the mRNA codon in Problem 28.24 was transcribed.
Problem 28.24
UAC is a codon for tyrosine it was transcribed from ATG of the template strand of a DNA chain.
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (16 reviews)
UAC is a codon for tyrosine it was transcribed ...View the full answer
Answered By
Larlyu mosoti
I am a professional writer willing to do several tasks free from plagiarism, grammatical errors and submit them in time. I love to do academic writing and client satisfaction is my priority. I am skilled in writing formats APA, MLA, Chicago, and Harvard I am a statistics scientist and I can help out in analyzing your data. I am okay with SPSS, EVIEWS, MS excel, and STATA data analyzing tools.
Statistical techniques: I can do linear regression, time series analysis, logistic regression, and some basic statistical calculations like probability distributions. . I'm ready for your working projects!
Services I would offer:
• Academic writing.
• Article writing.
• Data entry.
• PDF conversion.
• Word conversion
• Proofreading.
• Rewriting.
• Data analyzing.
The best reason to hire me:
- Professional and Unique work in writing.
- 100% satisfaction Guaranteed
- within required time Express delivery
- My work is plagiarism Free
- Great communication
My passion is to write vibrantly with dedication. I am loyal and confident to give my support to every client. Because Client satisfaction is much more important to me than the payment amount. A healthy client-contractor relationship benefits in the longer term. Simply inbox me if you want clean work.
5.00+
3+ Reviews
10+ Question Solved
Related Book For
Question Posted:
Students also viewed these Organic Chemistry questions
-
Draw the complete structure of the following peptide. Ser-Gln-Met NH2
-
Draw the complete structure of the ribonucleotide codon UAC, for what amino acid does this sequence code?
-
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
-
Question 4: Partners M, N, and O agreed to share the net income or loss in the ratio of 5:4:3 respectively. Their capital balances were Rs.80, 000, Rs. 70, 000 and Rs. 60, 000. They decided that "O"...
-
What five entry modes do firms consider as paths to use to enter international markets? What is the typical sequence in which firms use these entry modes?
-
Refer to Exercise 1. a. To what value should the process mean be set to maximize the process capability? b. Is it possible to make the process capability acceptable simply by adjusting the process...
-
What are the main considerations in advertising planning? What are the key points related to each?
-
Elliot Karlin is a 35-year-old bank executive who has just inherited a large sum of money. Having spent several years in the banks investments department, hes well aware of the concept of duration...
-
In the current year, the building occupied by Surf Beach Citys Culture and Recreation Department suffered severe structural damage as a result of a hurricane. It had been 48 years since a hurricane...
-
Recast the Statement of Activities of the Illustrative VHWO/ONPO presented in Illustration, in a columnar format. Use one column for changes in each class of net assets and a totalcolumn. llustrative...
-
What anti codon sequences of tRNAs are coded for by the codons in Problem 28.21? Problem 28.21 For what amino acids do the following ribonucleotide triplets code? (a) AAU (b) GAG (c) UCC (d) CAU
-
Give an mRNA sequence that will code for synthesis of metenkephalin. Tyr-Gly-Gly- Phe-Met
-
You are a student at the University of Arkansas and desperately want to attend the next Razorbacks basketball game. The problem is that the admission ticket costs $10, and you have only $5. You can...
-
1. A large group of students were asked what their favorite soft drink is. Below is the probability distribution for a student chosen at random liking a particular soft drink. Drink: Choka Kola CR...
-
Task: Identify a local (within 50km of North Bay) business and answer the following questions: Name of Business: 1. Is the business independent or is it a chain? What is one advantage of this...
-
What questions would you like to ask of Cassie to better understand any factors that may be affecting Sasha at this time? Growing sunflowers It's now week 6 into the growing sunflowers project. Your...
-
n rope is fixed to a wall and attached to the block such that the rope is parallel to the surface of the wedge. The 12 points) Consider the situation in the figure where a square block (mi) sits...
-
The rooms division department consists of front office, reservations, housekeeping, concierge, guest services, and communications. LO.1
-
Research corporate acquisitions using Web resources and then answer the following questions: Why do firms purchase other corporations? Do firms pay too much for the acquired corporation? Why do so...
-
Eighteen kilograms of the refrigerant HFC-134a at 150C is contained in a 0.03-m 3 tank. Compare the prediction you can make for the pressure in the tank with that obtained using Fig. 3.3-4. For data,...
-
Draw the structures of the following RNA components: a. UCC b. CAA c. ACG
-
Using eq. 18.2 as a guide, write an equation for hydrolysis of a. 2-deoxythymidine b. 2-deoxyguanosine
-
Consider the following mRNA sequence: 5' A--G--C--U--C--G--U--A--C 3' Draw the segment of DNA double helix from which this sequence was derived, using the schematic method shown at the right of...
-
The tolal landed coet with the order gaantly sire of 6,000 unts is 4 (Enter your response roundod to the nearest dolar)
-
Boyne Inc. had beginning inventory of $12,000 at cost and $20,000 at retail. Net purchases were $120,000 at cost and $170,000 at retail. Net markups were $10,000, net markdowns were $7,000, and sales...
-
Apple inc. CONDENSED CONSOLIDATED BALANCE SHEETS (Unaudited) (In milions, except number of shares which are reflected in thousands and par value) LABILITES AND SHAREHOLDERS' EQUITY: Current...
Study smarter with the SolutionInn App