Each of the following pairs of primers has a problem with it. Tell why the primers would

Question:

Each of the following pairs of primers has a problem with it. Tell why the primers would not work well.

(a) Forward primer 5' GCCTCCGGAGACCCATTGG 3'

Reverse primer 5' TTCTAAGAAACTGTTAAGG 3'

(b) Forward primer 5' GGGGCCCCTCACTCGGGGCCCC 3'

Reverse primer 5' TCGGCGGCCGTGGCCGAGGCAG 3'

Reverse primer 5' CGGACCTTCATTGGCAATTCGA 3'

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Biochemistry

ISBN: 978-1285429106

8th edition

Authors: Mary K. Campbell, Shawn O. Farrell

See More Books

Question Posted: Jul 08, 2015 01:16 PM

See More Questions

Each of the following pairs of compounds undergoes a Bronsted acid-base reaction for which the equilibrium lies to the right. Give the products of each reaction, and identify the acid, the base, the...
Each of the following pairs of compounds undergoes a Bronsted acidbase reaction for which the equilibrium lies to the right. Give the products of each reaction, and identify the acid, the base, the...
A presidential candidate fears he has a problem with women voters. His campaign staff plans to run a poll to assess the situation. They'll randomly sample 300 men and 300 women, asking if they have a...
How are the square numbers embedded in Pascals triangle?
General American Investors Company, a closed-end regulated investment management company, invests primarily in medium- and high-quality stocks. Jim Campbell is studying the asset value per share for...
File Tools ACC 14 Solarce CM). Seved to this PC View ACC 154- Managerial Accounting Cost-Volume-Profit Analysis Excel Assignment Sales Volume 200,000 Smart Mirrors were sold this post year. Current...
What is implementation? AppendixLO1
On January 1, 20--, Dover Companys retained earnings accounts had the following balances: Appropriated for printing press........$ 50,000 Unappropriated retained earnings......800,000...
Ivanhoe Ltd. issued 740.000, 11%, 10-year bonds on December 31, 2019, for 670,000. Interest is payable annually on December 31. Ivanhoe Company uses the straight-line method to amortize bond premium...
The binary data stream 011100101 is applied to the input of a modified duobinary system. (a) Construct the modified duobinary coder output and corresponding receiver output without a precoder. (b)...
What are the criteria for good primers in a PCR reaction?
What is the functional difference between regular PCR and qPCCR?
Let $\mathcal{S}$ be the half-cylinder $x^{2}+y^{2}=1, x \geq 0,0 \leq z \leq 1$. Assume that $\mathbf{F}$ is a horizontal vector field (the $z$-component is zero) such that \(\mathbf{F}(0,...
Essay on: The Influence of Social Media on Individuals, Family, and Society. Also how social media influences us on a business end, how it influences us personally, and how they correlate.
A wastewater flow of 3550 m 3 /d is to be treated in a facultative pond system. The reaction rate coefficient at the average operating temperature is 0.35 d -1 . The pond system is assumed to behave...
Provide a brief overview using these environmental scanning steps as a guide: 1. Choose an industry of your interest such as technology, healthcare, retail, energy, etc. 2. Identify and briefly...
Your company is considering expanding into a new international market. Describe the market research you would conduct to evaluate the feasibility of entering this market, including factors such as...
Address the following from your Social Era research and the course scholarly literature: What are the key foundational underpinnings that shape the essence of what we call the social management era?...
The temperature at which a liquid is in equilibrium with its own vapour at a specified pressure is called the (a) Adiabatic temperature (b) Saturated temperature (c) Equilibrium temperature (d) None...
Global.asax is used for: a. declare application variables O b. all other answers are wrong O c. declare global variables O d. handle application events
What type of audit report (unqualified opinion, qualified opinion, adverse opinion, disclaimer of opinion) should the auditors generally issue in each of the following situations? Explain. a....
Can modification of enzymes of aerobic glycolysis play a role in cancer treatment?
What is the metabolic advantage in the conversion of glucose to lactate, in which there is no net oxidation or reduction?
Most hunters know that meat from animals that have been run to death tastes sour. Suggest a reason for this observation.
John has to choose between Project A and Project B, which are mutually exclusive. Project A has an initial cost of $30,000 and an internal rate of return of 16 percent. Project B has an initial cost...
Complete the table below, for the above transactions
You are evaluating a new project for the firm you work for, a publicly listed firm. The firm typically finances new projects using the same mix of financing as in its capital structure, but this...

Each of the following pairs of primers has a problem with it. Tell why the primers would

Question:

Step by Step Answer:

a The primers have very different GC content...View the full answer

Biochemistry

Students also viewed these Medical Sciences questions