Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. Exons b. Caps

Question:

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________.

a. Exons

b. Caps

c. Poly-A tails

d. Introns

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Concepts Of Biology

ISBN: 9781938168116

1st Edition

Authors: Samantha Fowler, Rebecca Roush, James Wise

See More Books

Question Posted: Sep 23, 2022 01:54 AM

See More Questions

A eukaryotic cell carrying out transcription and RNA processing is incubated with 32P-labeled ATP. Where will the radioactive isotope appear in mature mRNA if the ATP is labeled at the (a) position,...
During RNA processing A.) All of the exons are removed and discarded B.) The RNA molecule is made from a DNA template C.) Introns are cut from the RNA and the exons are spliced together D.) The RNA...
A mRNA strand has the sequence - 5CCAUCCGGCAUACCAAAUUACUAAACUAGC3-
According to Dr. Grant, creatives are people who ________. A. Are procrastinators B. Act on multiple ideas C. Plan out each detail D. Are highly confident with no doubts about their success
The treasurer of Westmark Industrial, Inc., a wholesale distributor of household appliances, wants to estimate his companys cash balances for the first three months of 2015. Using the information...
Luigi and Gina Cicello have decided to lease some newly built premises for the purpose of opening a seafood outlet. They intend to provide a wide range of different products, including a variety of...
Determine the value of e-a>u for each of the following cases: LO8 a. u = 2, a = 2 b. u = 2, a = 5 c. u = .8, a = 6 d. u = .4, a = .6
Yuka consumes mangos and oranges. She is given four mangos and three oranges. She can buy or sell mangos for $ 2 each. Similarly, she can buy or sell an orange for $ 1. If Yuka has no other source of...
plz solve!! A ponte show c. A Company proces products and matching proces Onits of 10000 song the weet Most of the 1. Fora the cost applicable to procura 2. Find the preparation of the the 000 G000...
Floral Gardens Incorporated is a nationwide chain of garden centres that operates as a private company. In 2014, it issued three new financial instruments. All three of these instruments are new to...
The RNA components of ribosomes are synthesized in the ________. a. Cytoplasm b. Nucleus c. Nucleolus d. Endoplasmic reticulum
A promoter is ________. a. A specific sequence of DNA nucleotides b. A specific sequence of RNA nucleotides c. A protein that binds to DNA d. An enzyme that synthesizes RNA
Work as a team with two or three other students in your class to select an organisation in your community that practises marketing. It may be a manufacturer, a service provider, a retailer, a...
Dr. Burgess oversees the pharmacy center within Hughes Regional Hospital. Dr. Burgess is planning on purchasing two medication dispensing units which she wants to pay back in a short-term period. The...
On January 1, 2021, Wetick Optometrists leased diagnostic equipment from Southern Corp., which had purchased the equipment at a cost of $1,831,401. The lease agreement specifies six annual payments...
Prevosti Farms and Sugarhouse pays its employees according to their job classification. The following employees make up Sugarhouse's staff: Employee Whatis late and Address Payroll information A -...
Image caption
Jamie Lee and Ross, now 57 and still very active, have plenty of time on their hands now that the triplets are away at college. They both realized that time has just flown by, over twenty-four years...
If the dominating term of a polynomial function is 10x 7 , what can we conclude about each of the following features of the graph of the function? (a) Domain (b) Range (c) End behavior (d) Number of...
Baxter, Inc., owns 90 percent of Wisconsin, Inc., and 20 percent of Cleveland Company. Wisconsin, in turn, holds 60 percent of Clevelands outstanding stock. No excess amortization resulted from these...
Certain proton pump inhibitors inhibit secretion of stomach acid and are among the most widely sold drugs in the world today. What pump does this type of drug inhibit, and where is this pump located?
The membrane potential in animal cells, but not in plants, depends largely on resting K + channels. How do these channels contribute to the resting potential? Why are these channels considered to be...
Patch clamping can be used to measure the conductance properties of individual ion channels. Describe how patch clamping can be used to determine whether or not the gene coding for a putative K +...
All of the following are included on Form 1040, page 1, EXCEPT: The determination of filing status. The Presidential Election Campaign check box. The income section. The paid preparer signature line.
Question One: (25 marks) (X) Inc. purchased 80% of the outstanding voting shares of (Y) for $360,000 on July 1, 2017. On that date, (Y) had common shares and retained earnings worth $180,000 and...
Regarding Enron, this was a company that resulted in the creation of the Sarbanes-Oxley Act and many reforms to the accounting profession. Research the company and answer the following...

Portions of eukaryotic mRNA sequence that are removed during RNA processing are ________. a. Exons b. Caps

Question:

Step by Step Answer:

In the process of RNA processing the introns are removed in th...View the full answer

Concepts Of Biology

Students also viewed these Life Sciences questions