The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
Question:
The fact that DNA sequences are more similar in more closely related organisms is evidence of what?
a. Optimal design in organisms
b. Adaptation
c. Mutation
d. Descent with modification
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 75% (12 reviews)
So when you analyze DNA and see the ...View the full answer
Answered By
Marvine Ekina
Marvine Ekina
Dedicated and experienced Academic Tutor with a proven track record for helping students to improve their academic performance. Adept at evaluating students and creating learning plans based on their strengths and weaknesses. Bringing forth a devotion to education and helping others to achieve their academic and life goals.
PERSONAL INFORMATION
Address: , ,
Nationality:
Driving License:
Hobbies: reading
SKILLS
????? Problem Solving Skills
????? Predictive Modeling
????? Customer Service Skills
????? Creative Problem Solving Skills
????? Strong Analytical Skills
????? Project Management Skills
????? Multitasking Skills
????? Leadership Skills
????? Curriculum Development
????? Excellent Communication Skills
????? SAT Prep
????? Knowledge of Educational Philosophies
????? Informal and Formal Assessments
0.00
0 Reviews
10+ Question Solved
Related Book For
Concepts Of Biology
ISBN: 9781938168116
1st Edition
Authors: Samantha Fowler, Rebecca Roush, James Wise
Question Posted:
Students also viewed these Life Sciences questions
-
Are individual stock returns more closely related to national or industry factors? What implication does this have for portfolio diversification?
-
In the pairs of DNA sequences below, the lower duplex represents a mutagenized daughter duplex. Identify the mutation as a transition, a transversion, an insertion, or a deletion. (a) (b) 5'...
-
The following are two DNA sequences from homologous genes: TTGCATAGGCATACCGTATGATATCGAAAACTAGAAAAATAGGGCGATAGCTAGTATGTTATCGAAAAGTAGCAAAATAGGGCGATAGCTACCCAGACTACCGGAT The two sequences, however, do...
-
A company has the following results for the three accounting periods to 31 March 2021: Assuming that all possible claims are made to relieve the trading loss against total profits, calculate the...
-
The costs of inspection for five product attributes A, B, C, D, and E are $10, $5, $4, $2, and $12, respectively. The cost of failure for each attribute is estimated to be $25 for A, $15 for B, $30...
-
Koolman Construction Company began work on a contract in 2019. The contract price is $3,000,000, and the company determined that its performance obligation was satisfied over time. Other information...
-
Individuals who report perceived wrongdoing of a corporation or public agency are known as whistle blowers. Two researchers developed an index to measure the extent of retaliation against a whistle...
-
A process is in statistical control with x = 199 and R = 3.5. The control chart uses a sample size of n= 4. Specifications are at 200 ± 8. The quality characteristic is normally distributed....
-
Partial-Year Depreciation Equipment acquired at a cost of $97,000 has an estimated residual value of $6,000 and an estimated useful life of 10 years. It was placed into service on October 1 of the...
-
4/9 Determine the force in each member of the loaded truss. 30 B 30 30 3 kN D. Problem 4/9
-
Which situation would most likely lead to allopatric speciation? a. A flood causes the formation of a new lake. b. A storm causes several large trees to fall down. c. A mutation causes a new trait to...
-
The wing of a bird and the arm of a human are examples of ________. a. Vestigial structures b. Molecular structures c. Homologous structures d. Analogous structures
-
For problems involving composite bodies composed of two or more materials, the elasticity solution requires both boundary conditions and interface conditions between each material system. The...
-
Give your overall opinion . What do you think about neuromarketing? Is it usefull or is it a waste of time? Some people think this practice is "Orwellian", do you agree? Can marketers manage the...
-
Question 1. Let z= f(x,y), x = g (s, t). and ' y = h (s, t). with f, g & h all differentiable. (a) Set up an appropriate tree diagram for the of chain rule as done in this module's Use video lessons:...
-
ow do synergistic dynamics emerge within high-performance teams, and what role do diverse skill sets, complementary roles, and shared goals play in fostering collaborative innovation and collective...
-
(14%) Problem 3: The circuit shown contains a voltage source with emf & = 5.99 V, a resistor with resistance R = 135 k2, and a capacitor with capacitance C = 507 nF. When switch S is set to position...
-
1. What functions do all managers perform regularly? How do these functions apply to the three levels of management found in most organizations? 2. Identify and distinguish between the different...
-
In each scatter diagram, tell whether a linear or a quadratic model is appropriate for the data. If linear, tell whether the slope should be positive or negative. If quadratic, tell whether the...
-
Economic feasibility is an important guideline in designing cost accounting systems. Do you agree? Explain.
-
RNA was extracted from TMV (tobacco mosaic virus) particles and found to contain 20 percent cytosine (20 percent of the bases were cytosine). With this information, is it possible to predict what...
-
DNA was extracted from cells of Staphylococcus afermentans and analyzed for base composition. It was found that 37 percent of the bases are cytosine. With this information, is it possible to predict...
-
If one strand of DNA in the WatsonCrick double helixhas a base sequence of 5-GTCATGAC-3, what is the base sequence of the complementary strand?
-
Long-term liabilities are shown in two places in the business firm's balance sheet depending upon when the long-term liabilities are scheduled for payment. True False
-
Julio is single with 1 withholding allowance. He earned $1,025.00 during the most recent semimonthly pay period. He needs to decide between contributing 3% and $30 to his 401(k) plan. If he chooses...
-
Acquirer firm plans to launch a takeover of Target firm. The manager of Acquirer indicates that the deal will increase the free cash flow of the combined business by $13.6m per year forever. The beta...
Study smarter with the SolutionInn App