Consider the returns between Southeast Utilities and Precision Instruments for the period 20052014 The summary statistics for these two stocks are as follows Assume, for expositional purposes, we place equal amounts in each stock therefore, the weights are 0 5 and 0 5 Return ( ) Standard deviation ...

The Answer is in the image, click to view ...

Consider the returns between Southeast Utilities and Precision Instruments for the period 20052014. The summary statistics for

Question:

Consider the returns between Southeast Utilities and Precision Instruments for the period 2005–2014. The summary statistics for these two stocks are as follows:

Return (%) Standard deviation (%) Correlation coefficient Southeast Precision 10.1 16.8 0.29 15.4 27.5

Assume, for expositional purposes, we place equal amounts in each stock; therefore, the weights are 0.5 and 0.5:

o = [w0 + w0 + 2(w)(w) (P2)0102]/ 1/2 =[(0.5) (16.8) + (0.5) (27.5) +2(0.5) (0.5)(0.29) (16.8) (27.5) ]/ =

Fantastic news! We've Found the answer you've been seeking!

Step by Step Answer:

Related Book For book-img-for-question

Investments Analysis And Management

ISBN: 9781118975589

13th Edition

Authors: Charles P. Jones, Gerald R. Jensen

See More Books

Question Posted: Dec 31, 2023 10:34 AM

See More Questions

what ways does the study of phenotypes inform our understanding of complex biological phenomena, including disease susceptibility, ecosystem dynamics, and evolutionary processes, providing insights...
Write a program that read a sequence of integer inputs and print (20 Points) a) The Smallest and largest of the inputs. b) The number of even and odd inputs. c) Cumulative totals. For example, if the...
Identify the polypeptide encoded by the DNA sequence below, in which the lower strand serves as the template for mRNA synthesis? 5 GGACCTATGATCACCTGCTCCCCGAGTGCTGTTTAGGTGGG 3 3'...
Select the reasons why most professional telescopes are reflectors rather than refractors. A mirror can collect light more efficiently than a lens. Reflecting telescopes have shorter focal lengths...
Two firms, U and L, are identical except for their capital structure. Both will earn $150 in a boom and $50 in a slump. There is a 50 percent chance of each event. U is entirely equity-financed, and...
Various cost and sales data for Meriwell Company for the just completed year appear in the worksheet below: Finished goods inventory, beginning $20,000 Finished goods inventory, ending $40,000...
10. How are assets and liabilities denominated in foreign currency measured and recorded at the transaction date? At the balance sheet date?
Cybernetics Inc. issued $60 million of 5% three-year bonds, with coupon paid at the end of every year. The effective interest rate at the beginning of Years 1, 2, and 3 was 8%, 5%, and 2%. Required:...
E11-20A (similar to) Question Help Last month, Baxter Corporation purchased and used the same quantity of material in producing its product, speed bumps for traffic control (Click the icon to view...
Extending Example 7-6, the correlation between Southeast Utilities and Precision Instruments returns is +0.29. In order to focus on the effects of a changing correlation coefficient, we continue to...
The risk of a portfolio declines quickly as more securities are added. Using Equation 7-8 and assuming that each securitys standard deviation is 20 percent, the risk of a 100security portfolio is...
Now suppose that the disturbances are not normally distributed, although is still known. Show that the limiting distribution of previous statistic is (1/J) times a chisquared variable with J degrees...
Simon Company's year-end balance sheets follow. At December 31 Assets Cash Accounts receivable, net Merchandise inventory Prepaid expenses Plant assets, net Total assets Liabilities and Equity...
Openthe Phetsimulation Charges and Field from this link: ( https://phet.colorado.edu/en/simulation/charges-and-fields ) . In this simulation, a little different model is used: the little yellow "E...
A particle of mass m that is moving along the x-axis is experiencing a restoring force of the form F = -k+x, where kf is the spring constant. The Hamiltonian for this system is given as: = d 2m dx +...
Distinguish carefully between the following terms: i) Resolution and Sensitivity. ii) Type A and Type B evaluations of measurement uncertainty. [30%] (b) Describe two common schemes used for the...
Write out the form of the partial fraction decomposition of the function (See Example). Do not determine the numerical values of the coefficients. (a) +3 x5 + 2x3 A B C x Dx + E ++++ 2+2 6 (b)...
In a many-country static trade model, suppose that country i receives a transfer of income from country j and there are no other intergovernmental transfers. Does this imply that i will have...
The trade-off theory relies on the threat of financial distress. But why should a public corporation ever have to land in financial distress? According to the theory, the firm should operate at the...
a. If a taxpayer must travel away from his or her home in order to obtain medical care, which en route costs, if any, are deductible as medical expenses? b. Are there any limits imposed on the...
What are the rules dealing with the deductibility of the cost of meals and lodging incurred while away from home in order to receive medical treatment as an outpatient?
a. Which types of capital expenditures incurred specifically for medical purposes are deductible? b. What limitations, if any, are imposed on the deductibility of these expenditures?
Eye Deal Optometry leased vision - testing equipment from Insight Machines on January 1 , 2 0 2 4 . Insight Machines manufactured the equipment at a cost of $ 2 0 0 , 0 0 0 and lists a cash selling...
help! ee all photos + Add to o e D C N X Edit & Create Share Table of Contents No sales to an individual customer accounted for more than 10% of revenue during any of the last three fiscal years. Net...
Business law A person may have the liability of a partner even though no partnership exists True False

Consider the returns between Southeast Utilities and Precision Instruments for the period 20052014. The summary statistics for

Question:

Return (%) Standard deviation (%) Correlation coefficient Southeast Precision 10.1 16.8 0.29 15.4 27.5

Step by Step Answer:

Investments Analysis And Management

Students also viewed these Business questions