Question: Four bases (A, C, T, and G) appear in DNA. Assume that the appearance of each base in a DNA sequence is random. a. What

Four bases (A, C, T, and G) appear in DNA. Assume that the appearance of each base in a DNA sequence is random.

a. What is the probability of observing the sequence AAGACATGCA?

b. What is the probability of finding the sequence GGGGGAAAAA?

c. How do your answers to parts (a) and (b) change if the probability of observing A is twice that of the probabilities used in parts (a) and (b) of this question when the preceding base is G?

Step by Step Solution

★★★★★

3.30 Rating (159 Votes )

There are 3 Steps involved in it

1 Expert Approved Answer

Step: 1 Unlock

a There are four choices for each base and the probability of obser... View full answer

Question Has Been Solved by an Expert!

Get step-by-step solutions from verified subject matter experts

Step: 2 Unlock

Step: 3 Unlock

Students Have Also Explored These Related Physical Chemistry Questions!

Consider the following model: GNP t = 1 + 2 M t + 3 M t1 + 4 (M t M t1 ) + u t where GNP t = GNP at time t,M t = money supply at time t, Mt 1 = money supply at time (t 1), and (M t M t1 ) =...

For each of the following gas-phase reactions, write the rate expression in terms of the appearance of each product and disappearance of each reactant: (a) 2 H2O(g) -- 2 H2(g) + O2(g) (b) 2 SO2(g) +...

The sense strand of a segment of DNA has the following sequence of bases: 5' . . . T G G G G G T T T T A C A G C . . . 3' (a) What mRNA sequence would result from this segment? (b) Assume that the...

The base sequences in mRNA that code for certain amino acids are Glu: GAA, GAG Val: GUU, GUC, GUA, GUG Met: AUG Trp: UGG Phe: UUU,UUC Asp: GAU, GAC These sequences are complementary to the sequences...

Probability Problem Set Instructions You need to include these 3 parts in each of your responses to the problem sets. Set Up theEquations Use the Equations/Mathematical Manipulation and Operations...

Written Homework Problems: Week 10 Problem 1: Probability of DNA sequences Assume that the four bases A, C, T, and G occur with equal likelihood in a DNA sequence of nine monomers. A. What is the...

Assume that the four bases A, C, T, and G occur with equal likelihood in a DNA sequence of nine monomers. (a) What is the probability of finding the sequence AAATCGAGT through random chance? (b) What...

Assume that the four bases A , C , T , and G occur with equal likelihood in a DNA sequence of monomers. i . WhatistheprobabilityoffindingthesequenceAAATCGAGTthroughrandomchance? ii . What is the...

Question 1. DNA is made up of four bases (A,C,T,G). Assume that the appearance of each base in a DNA sequence is random. (a) What is the probability of observing the sequence AAACGTACGG through...

5. Assume you are given a DNA sequence (string) using four bases A, C, G, and T: dnaStr: TGCGTGCTACCACATCATGCAGTTTTCAAAGAAGAAAGCCTCACCACAAA Write a program that: 1. Defines a string of 30 characters....

need help with my java howework assignment. we have only discussed loops and arrays for this assignment. also must have all code in the main block only. cant have any sub-mains since we havent...

Given that the vapor pressure of n-butane at 350 K is 9.4573 bar. Apply the four generic cubic EOS: (a) van der Waals EOS, (b) Redlich-Kwong EOS, (c) Soave-Redlich-Kwong EOS, and (d) Peng-Robinson...

A hot-wire anemometer consists of a 5 m diameter platinum wire, 5 mm long. The probe is operated at constant current of 0.03 amp. The electrical resistivity of platinum is 17Wcm at 20C and increases...

The following are important tasks in capital budgeting: Multiple select question. Identify the need for resultant cash flow Identify the amount of resultant cash flow Identify the timing of resultant...

A farm grows wheat and produces pork. The mar- ginal cost of producing each of these products increases as more of it is produced. a. Make a graph that illustrates the farm's PPF. b. The farm adopts...

Phenylalanine (Phe, 4) is a naturally occurring amino acid. What is the energy of interaction between its phenyl group and the electric dipole moment of a neighbouring peptide group? Take the...

Draw examples of the arrangements of electrical charges that correspond to monopoles, dipoles, quadrupoles, and octupoles. Suggest a reason for the different distance dependencies of their electric...

Acetic acid vapour contains a proportion of planar, hydrogen bonded dimers (2). The apparent dipole moment of molecules in pure gaseous acetic acid has a magnitude that increases with increasing...

A join in which the joining condition is based on equality between values in the common columns is called

Find the APR, or stated rate, in each of the following cases (Do not round intermediate calculations. Enter your answers as a percent rounded to 2 decimal places, e.g., 32.16.) : Stated Rate (APR)...

baring one shift, the express lane clerk recorded how many times customers violated the '10 items or less" ' rule for his lane. In particular, he recorded how many items over the limit each violator...