A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment
Question:
When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?
Transcribed Image Text:
3'-A ACTGTACGTGCTACCTTGCTGATATTACT- TII!!|!||||||||||||||||I|I!|||| 5'-TİGACATGĊAĊGÁTĠGAÁCĠACTATÁÁTGA- GCAATGGGCTGTATCGATGCȚẠCTGCTAT-5' TII|||||||TI|||||||||T||||||| CGTTAČČČGÁČÁŤÁGČŤÁČGÁTGÁČGÁŤÁ-3'
Fantastic news! We've Found the answer you've been seeking!
Step by Step Answer:
Answer rating: 64% (14 reviews)
Given the consensus 35 and 10 sequences in ...View the full answer
Answered By
Asim farooq
I have done MS finance and expertise in the field of Accounting, finance, cost accounting, security analysis and portfolio management and management, MS office is at my fingertips, I want my client to take advantage of my practical knowledge. I have been mentoring my client on a freelancer website from last two years, Currently I am working in Telecom company as a financial analyst and before that working as an accountant with Pepsi for one year. I also join a nonprofit organization as a finance assistant to my job duties are making payment to client after tax calculation, I have started my professional career from teaching I was teaching to a master's level student for two years in the evening.
My Expert Service
Financial accounting, Financial management, Cost accounting, Human resource management, Business communication and report writing. Financial accounting : • Journal entries • Financial statements including balance sheet, Profit & Loss account, Cash flow statement • Adjustment entries • Ratio analysis • Accounting concepts • Single entry accounting • Double entry accounting • Bills of exchange • Bank reconciliation statements Cost accounting : • Budgeting • Job order costing • Process costing • Cost of goods sold Financial management : • Capital budgeting • Net Present Value (NPV) • Internal Rate of Return (IRR) • Payback period • Discounted cash flows • Financial analysis • Capital assets pricing model • Simple interest, Compound interest & annuities
4.40+
65+ Reviews
86+ Question Solved
Related Book For
Principles of Genetics
ISBN: 978-1119142287
7th edition
Authors: D. Peter Snustad, Michael J. Simmons
Question Posted:
Students also viewed these Life Sciences questions
-
A segment of DNA containing 20 base pairs includes 7 guanine residues. How many adenine residues are in the segment? How many uracil residues are in the segment?
-
A segment of DNA has the following sequence: TTGGATGCTGG AACCTACGACC A. What would be the sequence immediately after reaction with nitrous acid? Let the letters H represent hypoxanthine and U...
-
A segment of DNA is put in place and stretched. Figure P7.82 shows a graph of the force exerted on the DNA as a function of the displacement of the stage. Based on this graph, which statement is the...
-
A palindrome is a string that is the same backward as it is forward. For example,tot and otto are rather short palindromes. Write a program that lets a user enter a string and that passes to a bool...
-
In Example 4.21 on page 194, we discussed randomly selecting, without replacement, two students from Professor Weiss's introductory statistics class. Suppose now that three students are selected...
-
Water waves approach an underwater shelf where the velocity changes from 2.8 m/s to 2.1 m/s. If the incident wave crests make a 34o angle with the shelf, what will be the angle of refraction?
-
Interim acquisition On March 31, 2014, Wero CA purchased 30 percent interest in Javier CA by paying $450,000 cash. The book values of Javier CAs assets and liabilities were equal to the fair values...
-
Quattro, Inc. has the following mutually exclusive projects available. The company has historically used a 4-year cutoff for projects. The required return is 11 percent. a. Compute the payback for...
-
14. Bond X is noncallable and has 20 years to maturity, a 10% annual coupon, and a $1,000 par value. Your required return on Bond X is 12%; if you buy it, you plan to hold it for 5 years. You (and...
-
The county collector of Sun County is responsible for collecting all property taxes levied by funds and governments within the boundaries of the county. To reimburse the county for estimated...
-
A segment of DNA in E. coli has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
A segment of human DNA has the following sequence of nucleotide pairs: When this segment of DNA is transcribed by RNA polymerase, what will be the sequence of nucleotides in the RNA transcript?...
-
Suppose our prior belief is is just as likely to be below 8 as it is to be above 8. (Our prior distribution g() has median 8.) Determine an S x an inverse chi-squared(k) that matches our prior...
-
Popcorn company is expected to pay $1 dividend per share at the end of this year, $1.50 dividend per share at the end of year 2, $2 dividend per share at the end of year 3, and $2.50 dividend per...
-
Increased spending for COVID economic relief is an important issue for many struggling in the current economy. A specific policy to combat this issue is put forward and it is found that 78% of...
-
James worked a total of 186 hours for the month of June 2020. His rate per hour is working hours of the 450 per hour. Overtime premium is 30%. The company is 8 hours a day. The company's regular...
-
Question Researchers collected a simple random sample of 36 children who had been identified as gifted in a large city. The following histograms show the distributions of the IQ scores of mothers and...
-
Shown below is activity for one of the products of Denver Office Equipment: January 1 balance, 700 units @ $55 per unit $38,500 Purchases: January 10: 700 units @ $60 per unit January 20: 1,100 units...
-
In Exercises determine whether the differential equation is linear. Explain your reasoning. 2xy - y' In x = y
-
Explain the buyers position in a typical negotiation for a business. Explain the sellers position. What tips would you offer a buyer about to begin negotiating the purchase of a business?
-
Once cells have differentiated to their final specialized forms, they never again alter expression of their genes. Is the statement true? Explain why or why not.
-
CG islands are thought to have arisen during evolution because they were associated with portions of the genome that remained unmethylated in the germ line. Is the statement true? Explain why or why...
-
In most differentiated tissues, daughter cells retain a memory of gene expression patterns that were present in the parent cell through mechanisms that do not involve changes in the sequence of their...
-
An estimated 84 percent of enterprises now use cloud computing solutions involving multiple clouds, whereas less than 10 percent of large organizations employ just a single public cloud. Group of...
-
XYZ inc. was involved in a tax dispute with the national tax authority. The companys legal counsel estimates that there is a 75% likelihood that the company will lose the dispute and that the amount...
-
3 . Accounting.. How does depreciation impact financial statements, and what are the different methods of depreciation?
Study smarter with the SolutionInn App