To study the function of a gene in detail, you downloaded a piece of genomic sequence for this gene from the NCBI database.

5’ - ATGAACACTTCGGAAGGTTGTATCGGTGGTCGATTC - 3’

a. (10 pts) Write down the mRNA sequence and translate it into protein sequence, assuming that 5’-ATG is the first codon. (find codon table in your textbook or online)

b. (10 pts) Comparing this amino acid sequence to the recorded protein sequence on NCBI, you found that most of the sequence match perfectly however the last two amino acids are different. You are sure this is the same gene. What could be the problem?

c. (15 pts) It was found that in many tumor cells, a “T” (underlined) is substituted by “G” in this DNA sequence. What kinds of mutation is this? What change in amino acid sequence can be predicted? Based on the feature of this amino acid, predict the potential effect on the protein function.

d. (15 pts) Based on the literatures you hypothesize that this sequence can direct the localization of protein X to nucleus. Please design a project to test this hypothesis. (Briefly describe your strategy. No model answers. Designing more than one methods will obtain gift points.)