FREE Trial
Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show its complementary sequence (be sure to show/label the 3'- and

image text in transcribed

1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show its complementary sequence (be sure to show/label the 3'- and 5' ends); (b) Estimate its Tm using the rule of thump method; (c) Calculate the Tm of 0.1 uM of the oligonucleotide in an aqueous buffer solution containing 100 mm NaCl and 2 mM MgCl2 @ pH 7.0 using the nearest neighbor method

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Transport Processes And Separation Process Principles

Transport Processes And Separation Process Principles

Authors: Christie Geankoplis, Allen Hersel, Daniel Lepek

5th Edition

0134181026, 978-0134181028

More Books

Students also viewed these Chemical Engineering questions

Question

★★★★★
Milo Corporation's unadjusted trial balance at December 1, 2017, is presented below. The following transactions occurred during December. Dec. 2 Purchased equipment for $16,000, plus sales taxes of...

Answered: 1 week ago

Question

★★★★★
1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show its complementary sequence (be sure to show/label the 3'- and 5' ends); (b) Estimate its Tm using...

Answered: 1 week ago

Question

★★★★★
(MATLAB) 1. Generate & plot both the CA & the DA signals in one graph. Set the plot of the DA signal to display samples as red 'o'. Also, you should get the sampling interval & number of samples on...

Answered: 1 week ago

Question

★★★★★
You haven't been getting much sleep lately and want to see how you compare to the average CSU student. You plan to sample students and ask them how many hours they sleep per night Then you will use...

Answered: 1 week ago

Question

★★★★★
34. Which of the following producers is employing practices that will support proper annuity product analyses to ensure a product is in the client's best interest? Oa. Kevin, who limits his...

Answered: 1 week ago

Question

★★★★★
1. What are the advantages and disadvantages of visual contracts? 2. Pick a jurisdiction highlighted in Module 6 and give a short comparison of contract law of that jurisdiction with Australia. 3....

Answered: 1 week ago

Question

★★★★★
According to Franklin, borrowing and lending is perfectly acceptable for Protestants. Any Protestant who has cash, he says, can lend it out an interest rate without religious implications. True False

Answered: 1 week ago

Question

★★★★★
Ex. 2-Weighted average shares outstanding. On January 1, 2013, Warren Corporation had 1,000,000 shares of common stock outstanding. On March 1, the corporation issued 150,000 new shares to raise...

Answered: 1 week ago

Question

★★★★★
=+ How much do the major football or basketball programs contributedirectly or indirectly to other parts of a typical university?

Answered: 1 week ago

Question

★★★★★
=+What is the local economic

Answered: 1 week ago

Question

★★★★★
=+company feels overworked; few people can imagine adding another

Answered: 1 week ago

Previous Question Next Question