1. An oligonucleotide (a short DNA or RNA) has the following sequence: ACGTGGTTCCATGGTACGGC (a) Show its complementary sequence (be sure to show/label the 3'- and 5' ends); (b) Estimate its Tm using the rule of thump method; (c) Calculate the Tm of 0.1 uM of the oligonucleotide in an aqueous buffer solution containing 100 mm NaCl and 2 mM MgCl2 @ pH 7.0 using the nearest neighbor method