4. Part of the MRNA sequence of an exon of a gene that encodes a bood protein is: AUGACUCAUCGCUGUAGUUUACGA Consult the genetic code to answer the following questions: a. What is the sequence of amino acids that this MRNA encodes? b. What is the sequence if a point mutation changes the tenth base from a C to an A? c. What is the effect of a point mutation that changes the fifteenth base from a U to an A? d. How does the encoded amino acid sequence change if a C is inserted between the fourth and fifth bases? e. Which would be more devastating to the encoded amino acid sequence, insertion of three bases in a row, or insertion of two bases in a row?