2. (10 points) Write a python code that finds the one letter protein sequence of a given DNA sequence shown below. Your code should print or display final sequence on Phyton console shown below. Create a reference list variable that includes the three letter protein sequence and RNA sequence shown in figure 1. Your code should use the reference list to match three letter codes in a given DNA sequence (dnaSeq) and print the protein sequence results shown in figure 2. dnaSeq="TTTTTCTCTTCCTCCTCCTCCTCGTTCTCG' Inde Value Type Size List 2 list 2 List 2 1 2 [*LU", "Phe'] ['UCU', 'Ser'i CUCC', 'Ala'] [UUC', 'Val'l CUCG', 'Trp') 3 2 list list 4 2 Figure 1. In (20): proteinSeq Out (20): ('Phe', 'Val', 'Ser', 'Ala', 'Ala', 'Ala', 'Ala', 'Trp', 'Val', 'Trp'l In (21): Figure 2