3. (4%) Biologists use a sequence of the letters A, C, T, and G to model...
Fantastic news! We've Found the answer you've been seeking!
Question:
Transcribed Image Text:
3. (4%) Biologists use a sequence of the letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3, and the gene does not contain any of the triplets ATG, TAG, TAA, or TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, display "no gene is found". Here are two sample runs: Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT TTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found 2 3. (4%) Biologists use a sequence of the letters A, C, T, and G to model a genome. A gene is a substring of a genome that starts after a triplet ATG and ends before a triplet TAG, TAA, or TGA. Furthermore, the length of a gene string is a multiple of 3, and the gene does not contain any of the triplets ATG, TAG, TAA, or TGA. Write a program that prompts the user to enter a genome and displays all genes in the genome. If no gene is found in the input sequence, display "no gene is found". Here are two sample runs: Enter a genome string: TTATGTTTTAAGGATGGGGCGTTAGTT TTT GGGCGT Enter a genome string: TGTGTGTATAT no gene is found 2
Expert Answer:
Answer rating: 100% (QA)
Heres a Python program that implements the described functionality def findgenesgenome genes startcodon ATG stopcodons TAG TAA TGA index 0 while index ... View the full answer
Related Book For
Building Java Programs A Back To Basics Approach
ISBN: 9780135471944
5th Edition
Authors: Stuart Reges, Marty Stepp
Posted Date:
Students also viewed these programming questions
-
A manufacturing firm located in Chicago ships its product by railroad to Detroit. Several different routes are available, as shown in the following diagram, referred to as a network: Each circle in...
-
1. Do you think it is practical to have a contingency budget for your scheduled business travel? Expound your answer. 2. Would it be wise to use yourlast year's breakdown of the corporate travel...
-
Could you please help complete the following java code. Help is needed where //*** is throughout the code. import java.util.Arrays; import java.util.Random; import java.util.Scanner; // // Project 3...
-
Show by approximating with integrals that the number of distinct triples of integers between 0 and \(n\) is about \(n^{3} / 6\).
-
The following information is available for The Coca-Cola Company (in U.S. $ millions): In the notes to its financial statements, Coca-Cola disclosed that it uses the FIFO and average cost formulas to...
-
In 2015, Elspeth Corporation paid both regular tax ($2,714,000) and AMT ($129,300). The director of tax forecasts that Elspeth will be in an AMT position for 2016 and 2017. However, its tentative...
-
What is the purpose of representations and warranties? What are the limits of such clauses?
-
New Energy is evaluating a new biofuel facility. The plant would cost $4,000 million to build and has the potential to produce up to 40 million barrels of synthetic oil a year. The product is a close...
-
Iulo Company incurs $3,600,000 of overhead each year in three departments: Processing, Packaging, and Testing. The company performs 800 processing transactions, 200,000 packaging transactions, and...
-
Calculate some of the standard customer acquisition costs across different types of channels: (conversion rate means the percentage of people who purchased the item among all the people who watched...
-
Based on the following stocks in Kim's portfolio, what is her portfolio's beta coefficient? 1500 shares of Condor stock at $14 a share. The beta is 0.7 2500 shares of Golden Hawk stock at $23 a...
-
Is Spruce Point Capital Management a successful short seller producing useful forensic research reports? What is their usual analysis and research procedure to generate a "short" (sell) report? Show...
-
Based on your reading about evolutionary and existential approaches, answer the following: Explain the above proposition given by evolutionary psychologists in your own words. You can be specific by...
-
1. A company that is Monopoly and is Canadian -What is this company's line of business? -Why do you think this a Monopoly ? -Who are its Competitors ? -What about Elasticity of demand ? Pricing power...
-
1). An investment cost $500 and its expected to produce cash flows of $40 at the end of year1, $60 at the end of year2, $70 at the end of year3, and $516 at the end of year4. what rate of return...
-
A company paid $217.50 for an item. The original price was $296.60, but this was marked down 40%. If the operating expenses are 35% of the cost, find the operating loss and the absolute loss What is...
-
W Ltd and A Ltd are identical in all aspects except their capital structures. W Ltd is 100% equity financed and has cash earnings before interest and taxes (X) of $125,000. Assume that these earnings...
-
Should we separate the debt and equity features of convertible debt? Team 1: Pro separation: Present arguments in favor of separating the debt and equity features of convertible debt. Team 2: Against...
-
What is the output produced from the following statements? System.out.println("\ta\tb\tc"); System.out.println("\\\\"); System.out.println("'"); System.out.println("\"\"\""); System.out.println("C:...
-
Suppose the following array has been declared: What indexes will be examined as the middle element by a binary search for each of the following target values? What value will be returned? a. 103 b....
-
Write the output produced when the following method is passed each of the following maps: a. {two=deux, five=cinq, one=un, three=trois, four=quatre} b. {skate=board, drive=car, program=computer,...
-
Jud's Manufacturing Company produces one product, Kebo. Because of wide fluctuations in demand for Kebo, the Assembly Department experiences significant variations in monthly production levels. The...
-
Lorch Company uses budgets in controlling costs. The May 2002 budget report for the company's Packaging Department is as follows. The budget amounts in the report were on the master budget For the...
-
Lakem elder Dutch manufactures expensive watch eases sold as souvenirs. Three ol its sales departments are: Retail Sales, Wholesale Sales, and Outlet Sales. The Retail Sales Department is a profit...
Study smarter with the SolutionInn App