8.) Answer the following questions regarding the following DNA sequence. 3'TACGGGGATAGCCGGCGAATTAAATAGCTGTC - 5' A.) What is the MRNA sequence that would result from transcription of this sequence? Assume that the DNA would be read from left to right. B.) What is the amino acid sequence that would result from translation of the mRNA resulting from the sequence? See Codon Table on next page. 20 C.) What is the anti-codon found on the tRNA that would deliver the amino acid for the first codon in the MRNA sequence? D.) If the fourth nucleotide in the DNA sequence were deleted due to a mutation during DNA replication, what would the resulting amino acid sequence be? What type of mutation is this? E.) What impact would the mutation in the DNA sequence in PART D have on the function of the protein produced from original sequence? Why?