FREE Trial
Answered step by step
Verified Expert Solution
Link Copied!

Question

1 Approved Answer

Bioinformatics Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down the consensus profile [ 3 points] b) What is the score for the

Bioinformatics

image text in transcribed

Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down the consensus profile [ 3 points] b) What is the score for the sequence AAAAA against the profile (match =+3, mismatch =1 ) [5 points] Do your calculations either in the text box here, or on paper and upload a photo of it

Step by Step Solution

There are 3 Steps involved in it

Step: 1

blur-text-image

Get Instant Access to Expert-Tailored Solutions

See step-by-step solutions with expert insights and AI powered tools for academic success

Step: 2

blur-text-image

Step: 3

blur-text-image

Ace Your Homework with AI

Get the answers you need in no time with our AI-driven, step-by-step assistance

Get Started

Recommended Textbook for

Intelligent Image Databases Towards Advanced Image Retrieval

Intelligent Image Databases Towards Advanced Image Retrieval

Authors: Yihong Gong

1st Edition

1461375037, 978-1461375036

More Books

Students also viewed these Databases questions

Question

★★★★★
Who is normally responsible for the authorization of investment activities? Why is the authorization normally performed at this level?

Answered: 1 week ago

Question

★★★★★
In what ways are the Sampsons financing and investing decisions related? What should they do in the future before asking advice from investment advisers?

Answered: 1 week ago

Question

★★★★★
Compute E[X] and var[X] for the following distributions. (a) f (x) axa1, 0 x 1, a 0. (b) f (x) 1n , x 1, 2, ...,n. (c) f (x) 32 (x 1)2, 0 x 2.

Answered: 1 week ago

Question

★★★★★
Harold Reese must choose between two bonds: Bond X pays $95 annual interest and has a market value of $900. It has 10 years to maturity. Bond Z pays $95 annual interest and has a market value of...

Answered: 1 week ago

Question

★★★★★
Bioinformatics Consensus Given the following multiple sequence alignment: TTGGCTAGAATGGAATTGAC a) Write down the consensus profile [ 3 points] b) What is the score for the sequence AAAAA against the...

Answered: 1 week ago

Question

★★★★★
You recently read about the use and procedure for hypothesis testing. The purpose of this discussion is to provide you the opportunity to discuss what is involved in the process of hypothesis...

Answered: 1 week ago

Question

★★★★★
P-418 Journalizing and posting adjustme najed trial balance The sadest anal balance of Avery Air Puntication System at December 31, the das need for the adjustments follow AVERY AIR PURIFICATION...

Answered: 1 week ago

Question

★★★★★
KAS Felipe manufacturing produces D, E, F, H, and I as its final product. In the production, it under goes joint processing under D1, D2, D4, and D6. Further processing is needed to produce D, F, and...

Answered: 1 week ago

Question

★★★★★
the question. Suppose that computer literacy among people ages 40 and older is being studied and that the accompanying tables describes the probability distribution for four randomly selected people,...

Answered: 1 week ago

Question

★★★★★
Question 1 (3 points) Saved All questions related to Safaricom are independent and the amounts and values in each question are different. Read the question carefully each time. Safaricom makes two...

Answered: 1 week ago

Question

★★★★★
Entry Rules: Round your answer to the nearest DOLLAR or UNIT. Examples: If your answer is $504.472, enter 504 If your answer is $504.626, enter $505 If your answer is $504.00, enter 504 If your...

Answered: 1 week ago

Question

★★★★★
1. What particularly intrigues you about this innovation? Why do you think it is needed and might or might not work in your community?

Answered: 1 week ago

Question

★★★★★
2. In what ways might the innovation be adapted to your particular community characteristics or needs?

Answered: 1 week ago

Question

★★★★★
1. What are the major sources of stress in your life? What are the major sources of stress at work? Write down three sources of stress for which you can take some sort of action to change.

Answered: 1 week ago

Previous Question Next Question